FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640608_at:

>probe:Drosophila_2:1640608_at:560:377; Interrogation_Position=490; Antisense; GAAGCAGATGCTTTTCCGCTACCAG
>probe:Drosophila_2:1640608_at:465:295; Interrogation_Position=506; Antisense; CGCTACCAGGGTCATATCAGTGCCG
>probe:Drosophila_2:1640608_at:73:545; Interrogation_Position=550; Antisense; GGATAAGACTGGACCCCACATCTAT
>probe:Drosophila_2:1640608_at:368:93; Interrogation_Position=593; Antisense; AGTTCGGATAAGCTGCCGTACGCCA
>probe:Drosophila_2:1640608_at:31:583; Interrogation_Position=636; Antisense; TGGCCGCCATGACCGTTTTCGAAAG
>probe:Drosophila_2:1640608_at:247:503; Interrogation_Position=660; Antisense; GTCGCTGGAAACCTGACTTGTCCGA
>probe:Drosophila_2:1640608_at:60:299; Interrogation_Position=718; Antisense; CGCCTCCGGAGTGTTTAACGATCTG
>probe:Drosophila_2:1640608_at:175:41; Interrogation_Position=738; Antisense; ATCTGGGTTCGGGATCCAACATCGA
>probe:Drosophila_2:1640608_at:222:153; Interrogation_Position=756; Antisense; ACATCGATCTGTGTGTTATCCGCAA
>probe:Drosophila_2:1640608_at:679:39; Interrogation_Position=795; Antisense; ATCTGCGCAACTATGAGCTGGCTAA
>probe:Drosophila_2:1640608_at:146:223; Interrogation_Position=824; Antisense; AAGGGCAAGCGCCAGTTGGACTACC
>probe:Drosophila_2:1640608_at:478:727; Interrogation_Position=839; Antisense; TTGGACTACCGCTTCAAGACCGGAA
>probe:Drosophila_2:1640608_at:414:189; Interrogation_Position=884; Antisense; AACATTAAGGACCTACTCGTCACCG
>probe:Drosophila_2:1640608_at:243:331; Interrogation_Position=920; Antisense; GCGGTGCCCATGGAGATTTCTTAAA

Paste this into a BLAST search page for me
GAAGCAGATGCTTTTCCGCTACCAGCGCTACCAGGGTCATATCAGTGCCGGGATAAGACTGGACCCCACATCTATAGTTCGGATAAGCTGCCGTACGCCATGGCCGCCATGACCGTTTTCGAAAGGTCGCTGGAAACCTGACTTGTCCGACGCCTCCGGAGTGTTTAACGATCTGATCTGGGTTCGGGATCCAACATCGAACATCGATCTGTGTGTTATCCGCAAATCTGCGCAACTATGAGCTGGCTAAAAGGGCAAGCGCCAGTTGGACTACCTTGGACTACCGCTTCAAGACCGGAAAACATTAAGGACCTACTCGTCACCGGCGGTGCCCATGGAGATTTCTTAAA

Full Affymetrix probeset data:

Annotations for 1640608_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720