FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640609_at:

>probe:Drosophila_2:1640609_at:533:727; Interrogation_Position=160; Antisense; TTGGCCATTGCCGAGCTAGGTAAAC
>probe:Drosophila_2:1640609_at:158:33; Interrogation_Position=187; Antisense; ATAAGGCACATCATATCCCGAGGAA
>probe:Drosophila_2:1640609_at:564:433; Interrogation_Position=285; Antisense; GAGGAAAACCTCATACTACGACATT
>probe:Drosophila_2:1640609_at:669:17; Interrogation_Position=307; Antisense; ATTTGCGCCCAGATCAAGAGTCCAA
>probe:Drosophila_2:1640609_at:11:529; Interrogation_Position=356; Antisense; GGGATGCTGTCGATGCGAGCTTTAA
>probe:Drosophila_2:1640609_at:86:699; Interrogation_Position=376; Antisense; TTTAATGTCAACGAGCACTGCCAGG
>probe:Drosophila_2:1640609_at:215:365; Interrogation_Position=421; Antisense; GAATACATGGCCACTTTGCCGGAGT
>probe:Drosophila_2:1640609_at:312:93; Interrogation_Position=443; Antisense; AGTTCAGACGACGTGGCCTGGGCCA
>probe:Drosophila_2:1640609_at:118:121; Interrogation_Position=512; Antisense; AGCGGAAGCTTCCTCTTGAGATACT
>probe:Drosophila_2:1640609_at:444:725; Interrogation_Position=527; Antisense; TTGAGATACTCAACCAGCTGCCTGA
>probe:Drosophila_2:1640609_at:183:213; Interrogation_Position=567; Antisense; AAGACCGCAGGCCATTGTCGCAATA
>probe:Drosophila_2:1640609_at:674:665; Interrogation_Position=594; Antisense; TACATCCCAATCCTCGCAAATAATG
>probe:Drosophila_2:1640609_at:551:83; Interrogation_Position=650; Antisense; AGTGGCATTTTTCCGAGCTGAGGTC
>probe:Drosophila_2:1640609_at:470:353; Interrogation_Position=706; Antisense; GCAGCCCAGGCCTTTGAATATGCAG

Paste this into a BLAST search page for me
TTGGCCATTGCCGAGCTAGGTAAACATAAGGCACATCATATCCCGAGGAAGAGGAAAACCTCATACTACGACATTATTTGCGCCCAGATCAAGAGTCCAAGGGATGCTGTCGATGCGAGCTTTAATTTAATGTCAACGAGCACTGCCAGGGAATACATGGCCACTTTGCCGGAGTAGTTCAGACGACGTGGCCTGGGCCAAGCGGAAGCTTCCTCTTGAGATACTTTGAGATACTCAACCAGCTGCCTGAAAGACCGCAGGCCATTGTCGCAATATACATCCCAATCCTCGCAAATAATGAGTGGCATTTTTCCGAGCTGAGGTCGCAGCCCAGGCCTTTGAATATGCAG

Full Affymetrix probeset data:

Annotations for 1640609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720