FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640612_at:

>probe:Drosophila_2:1640612_at:227:471; Interrogation_Position=1049; Antisense; TTTAGACAAATATCCCTTACCCCTG
>probe:Drosophila_2:1640612_at:274:513; Interrogation_Position=1145; Antisense; GTGTTTTTTGTATGCCCCTTCTCCA
>probe:Drosophila_2:1640612_at:53:697; Interrogation_Position=648; Antisense; TTTACGCTCCTGGTCGTGGGCACGG
>probe:Drosophila_2:1640612_at:570:355; Interrogation_Position=667; Antisense; GCACGGGCCTCTTTGTGATGGGCAC
>probe:Drosophila_2:1640612_at:673:441; Interrogation_Position=683; Antisense; GATGGGCACCTTTGCCATCGCGGAT
>probe:Drosophila_2:1640612_at:567:449; Interrogation_Position=705; Antisense; GATCCGCAGAACACGTCGCAGGGAG
>probe:Drosophila_2:1640612_at:414:293; Interrogation_Position=721; Antisense; CGCAGGGAGTCGTGTTCTTCGTAGC
>probe:Drosophila_2:1640612_at:459:485; Interrogation_Position=741; Antisense; GTAGCGGGACTCATCTGCTTCATAC
>probe:Drosophila_2:1640612_at:625:683; Interrogation_Position=774; Antisense; TATCACGTCGTGTACATCTGGCTGG
>probe:Drosophila_2:1640612_at:383:43; Interrogation_Position=811; Antisense; ATCGAGGGTTCGACTTCTATCACCT
>probe:Drosophila_2:1640612_at:140:207; Interrogation_Position=850; Antisense; AAGCGTAAGCGGACATCTGGACAGT
>probe:Drosophila_2:1640612_at:698:557; Interrogation_Position=868; Antisense; GGACAGTCGAGCTGGTTGATCCATG
>probe:Drosophila_2:1640612_at:420:527; Interrogation_Position=905; Antisense; GGGAGAAGCCCCATCTATAAATATA
>probe:Drosophila_2:1640612_at:21:641; Interrogation_Position=932; Antisense; TCTGTGTTTGTTTATACCCGACCCG

Paste this into a BLAST search page for me
TTTAGACAAATATCCCTTACCCCTGGTGTTTTTTGTATGCCCCTTCTCCATTTACGCTCCTGGTCGTGGGCACGGGCACGGGCCTCTTTGTGATGGGCACGATGGGCACCTTTGCCATCGCGGATGATCCGCAGAACACGTCGCAGGGAGCGCAGGGAGTCGTGTTCTTCGTAGCGTAGCGGGACTCATCTGCTTCATACTATCACGTCGTGTACATCTGGCTGGATCGAGGGTTCGACTTCTATCACCTAAGCGTAAGCGGACATCTGGACAGTGGACAGTCGAGCTGGTTGATCCATGGGGAGAAGCCCCATCTATAAATATATCTGTGTTTGTTTATACCCGACCCG

Full Affymetrix probeset data:

Annotations for 1640612_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720