FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640616_at:

>probe:Drosophila_2:1640616_at:30:55; Interrogation_Position=1013; Antisense; ATGAGATTTACTCGTCCCGACTATC
>probe:Drosophila_2:1640616_at:514:683; Interrogation_Position=1060; Antisense; TATCTGCAACTATGCTTCACTCTAC
>probe:Drosophila_2:1640616_at:76:275; Interrogation_Position=1087; Antisense; CTTGGGCGCTCCAGTTTATGAGACT
>probe:Drosophila_2:1640616_at:415:213; Interrogation_Position=1142; Antisense; AAGAGCCACTTCTATCCGGGATTAT
>probe:Drosophila_2:1640616_at:86:297; Interrogation_Position=1175; Antisense; CGCGAGGTGTACGATCCCAATTGGT
>probe:Drosophila_2:1640616_at:219:567; Interrogation_Position=603; Antisense; GGCACAAGGCGGATTTCCTGCATGC
>probe:Drosophila_2:1640616_at:274:419; Interrogation_Position=716; Antisense; GAGCTGCAGTACTTGTCCATGCTAA
>probe:Drosophila_2:1640616_at:167:663; Interrogation_Position=738; Antisense; TAAATACCCGCACCTGTAAGTTGGA
>probe:Drosophila_2:1640616_at:685:133; Interrogation_Position=792; Antisense; ACGCCAACTCGGGTCAGAATCTGTG
>probe:Drosophila_2:1640616_at:477:85; Interrogation_Position=870; Antisense; AGTGCCTGGGTCTCTGGTTCAACGA
>probe:Drosophila_2:1640616_at:641:399; Interrogation_Position=908; Antisense; GACAGCAGCTTCATCGATTCTTTTA
>probe:Drosophila_2:1640616_at:56:405; Interrogation_Position=953; Antisense; GACTACGGTCACTTTGCCGAGTTAA
>probe:Drosophila_2:1640616_at:194:519; Interrogation_Position=980; Antisense; GTGGACAAAAACTTCGCCGTGGGCT
>probe:Drosophila_2:1640616_at:450:517; Interrogation_Position=998; Antisense; GTGGGCTGCTCCATCATGAGATTTA

Paste this into a BLAST search page for me
ATGAGATTTACTCGTCCCGACTATCTATCTGCAACTATGCTTCACTCTACCTTGGGCGCTCCAGTTTATGAGACTAAGAGCCACTTCTATCCGGGATTATCGCGAGGTGTACGATCCCAATTGGTGGCACAAGGCGGATTTCCTGCATGCGAGCTGCAGTACTTGTCCATGCTAATAAATACCCGCACCTGTAAGTTGGAACGCCAACTCGGGTCAGAATCTGTGAGTGCCTGGGTCTCTGGTTCAACGAGACAGCAGCTTCATCGATTCTTTTAGACTACGGTCACTTTGCCGAGTTAAGTGGACAAAAACTTCGCCGTGGGCTGTGGGCTGCTCCATCATGAGATTTA

Full Affymetrix probeset data:

Annotations for 1640616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720