FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640618_at:

>probe:Drosophila_2:1640618_at:373:723; Interrogation_Position=257; Antisense; TTGGAAGTTATGCTCTACGCGGCCG
>probe:Drosophila_2:1640618_at:699:411; Interrogation_Position=295; Antisense; GACCGCCATGGCGTTAATGCACAGC
>probe:Drosophila_2:1640618_at:436:709; Interrogation_Position=308; Antisense; TTAATGCACAGCCTGGTGACGTCGC
>probe:Drosophila_2:1640618_at:53:123; Interrogation_Position=355; Antisense; AGCGAAGATTTTCCTGGCTATGCTT
>probe:Drosophila_2:1640618_at:655:681; Interrogation_Position=373; Antisense; TATGCTTCCCTGGATGCTAGTGTGC
>probe:Drosophila_2:1640618_at:630:679; Interrogation_Position=390; Antisense; TAGTGTGCTGCATTCATTTTCTGAT
>probe:Drosophila_2:1640618_at:87:353; Interrogation_Position=427; Antisense; GCAGCTCAACGCGATTTTCAACATG
>probe:Drosophila_2:1640618_at:230:179; Interrogation_Position=468; Antisense; AAAAGGCTTTGATCTACGCCCTGGG
>probe:Drosophila_2:1640618_at:530:271; Interrogation_Position=505; Antisense; CATCTTTGGTTTGGCCCTGGAACAG
>probe:Drosophila_2:1640618_at:581:185; Interrogation_Position=525; Antisense; AACAGATGCTCCACTGGAACGTCGT
>probe:Drosophila_2:1640618_at:287:383; Interrogation_Position=541; Antisense; GAACGTCGTTTTCCATTTGATGACC
>probe:Drosophila_2:1640618_at:704:239; Interrogation_Position=574; Antisense; AATAACAAGCATCTCTAACACCCAA
>probe:Drosophila_2:1640618_at:513:465; Interrogation_Position=620; Antisense; GTTGGCAGACCGATTTCACTAATTT
>probe:Drosophila_2:1640618_at:4:493; Interrogation_Position=667; Antisense; GTAACTTACGCGTTTATGCTACATA

Paste this into a BLAST search page for me
TTGGAAGTTATGCTCTACGCGGCCGGACCGCCATGGCGTTAATGCACAGCTTAATGCACAGCCTGGTGACGTCGCAGCGAAGATTTTCCTGGCTATGCTTTATGCTTCCCTGGATGCTAGTGTGCTAGTGTGCTGCATTCATTTTCTGATGCAGCTCAACGCGATTTTCAACATGAAAAGGCTTTGATCTACGCCCTGGGCATCTTTGGTTTGGCCCTGGAACAGAACAGATGCTCCACTGGAACGTCGTGAACGTCGTTTTCCATTTGATGACCAATAACAAGCATCTCTAACACCCAAGTTGGCAGACCGATTTCACTAATTTGTAACTTACGCGTTTATGCTACATA

Full Affymetrix probeset data:

Annotations for 1640618_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720