Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640619_at:

>probe:Drosophila_2:1640619_at:445:675; Interrogation_Position=2620; Antisense; TAGAGAGCAGCATTTTGACCAAAGC
>probe:Drosophila_2:1640619_at:648:205; Interrogation_Position=2641; Antisense; AAGCTGCAACTTTCTCTACCATGAA
>probe:Drosophila_2:1640619_at:617:493; Interrogation_Position=2699; Antisense; GTAATGCCTGTAGTCAAACCTTCGC
>probe:Drosophila_2:1640619_at:407:175; Interrogation_Position=2714; Antisense; AAACCTTCGCGTAGCCTGCAGCAGG
>probe:Drosophila_2:1640619_at:219:621; Interrogation_Position=2746; Antisense; TGCTGACCAGAACTTACCCGACGAT
>probe:Drosophila_2:1640619_at:79:293; Interrogation_Position=2767; Antisense; CGATCAACATCGCAAGGTCACCCAG
>probe:Drosophila_2:1640619_at:283:651; Interrogation_Position=2784; Antisense; TCACCCAGCTCAAGGATCTTCTAGA
>probe:Drosophila_2:1640619_at:18:153; Interrogation_Position=2811; Antisense; ACATGTTTGCCTTAGATCCGGCTAA
>probe:Drosophila_2:1640619_at:587:451; Interrogation_Position=2839; Antisense; GATCTCCCTTAACCAGGCACTAGTT
>probe:Drosophila_2:1640619_at:383:555; Interrogation_Position=2854; Antisense; GGCACTAGTTCATCCATTCATACAG
>probe:Drosophila_2:1640619_at:697:211; Interrogation_Position=2938; Antisense; AAGACAACAATTCCCTAACTCAGCC
>probe:Drosophila_2:1640619_at:162:193; Interrogation_Position=2954; Antisense; AACTCAGCCGTTAGCTACTAGTTAT
>probe:Drosophila_2:1640619_at:604:469; Interrogation_Position=3053; Antisense; GTTCTGTGGTTTTAAGCTCTATGGC
>probe:Drosophila_2:1640619_at:167:337; Interrogation_Position=3068; Antisense; GCTCTATGGCGTTTTGAGAACCGAA

Paste this into a BLAST search page for me
TAGAGAGCAGCATTTTGACCAAAGCAAGCTGCAACTTTCTCTACCATGAAGTAATGCCTGTAGTCAAACCTTCGCAAACCTTCGCGTAGCCTGCAGCAGGTGCTGACCAGAACTTACCCGACGATCGATCAACATCGCAAGGTCACCCAGTCACCCAGCTCAAGGATCTTCTAGAACATGTTTGCCTTAGATCCGGCTAAGATCTCCCTTAACCAGGCACTAGTTGGCACTAGTTCATCCATTCATACAGAAGACAACAATTCCCTAACTCAGCCAACTCAGCCGTTAGCTACTAGTTATGTTCTGTGGTTTTAAGCTCTATGGCGCTCTATGGCGTTTTGAGAACCGAA

Full Affymetrix probeset data:

Annotations for 1640619_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime