FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640620_at:

>probe:Drosophila_2:1640620_at:466:547; Interrogation_Position=173; Antisense; GGATGAGCAGCTCACGCTACGGACC
>probe:Drosophila_2:1640620_at:633:413; Interrogation_Position=201; Antisense; GACCAGGATCGACGACCCACGGGAT
>probe:Drosophila_2:1640620_at:486:313; Interrogation_Position=238; Antisense; GCCACCGTTGTCGATCGCGATGAAT
>probe:Drosophila_2:1640620_at:722:445; Interrogation_Position=256; Antisense; GATGAATACAGTCCGCACAGAGGTG
>probe:Drosophila_2:1640620_at:404:53; Interrogation_Position=298; Antisense; ATGCTTAATGCCATGTCCAGACCTT
>probe:Drosophila_2:1640620_at:519:99; Interrogation_Position=316; Antisense; AGACCTTTAGGTCTGCCACGCCAAT
>probe:Drosophila_2:1640620_at:310:241; Interrogation_Position=355; Antisense; AATAGAGCACCCGTGTCGTATTTGC
>probe:Drosophila_2:1640620_at:432:421; Interrogation_Position=426; Antisense; GAGCAACCTGGATCAAGGACCCCAA
>probe:Drosophila_2:1640620_at:462:425; Interrogation_Position=458; Antisense; GAGAGCTTTATCCACTGCTGCATCA
>probe:Drosophila_2:1640620_at:501:669; Interrogation_Position=607; Antisense; TACTCCGTGCAGGACACATCGTTTG
>probe:Drosophila_2:1640620_at:552:125; Interrogation_Position=639; Antisense; ACCAAGATCCCTGCGCGAAGAGTTC
>probe:Drosophila_2:1640620_at:338:647; Interrogation_Position=665; Antisense; TCAGTCCCACCATGAGCAAGGTCGA
>probe:Drosophila_2:1640620_at:725:421; Interrogation_Position=678; Antisense; GAGCAAGGTCGAAGCTGTCACCCAC
>probe:Drosophila_2:1640620_at:413:305; Interrogation_Position=747; Antisense; CCTGAGCACGGATCGGTTCTATTAA

Paste this into a BLAST search page for me
GGATGAGCAGCTCACGCTACGGACCGACCAGGATCGACGACCCACGGGATGCCACCGTTGTCGATCGCGATGAATGATGAATACAGTCCGCACAGAGGTGATGCTTAATGCCATGTCCAGACCTTAGACCTTTAGGTCTGCCACGCCAATAATAGAGCACCCGTGTCGTATTTGCGAGCAACCTGGATCAAGGACCCCAAGAGAGCTTTATCCACTGCTGCATCATACTCCGTGCAGGACACATCGTTTGACCAAGATCCCTGCGCGAAGAGTTCTCAGTCCCACCATGAGCAAGGTCGAGAGCAAGGTCGAAGCTGTCACCCACCCTGAGCACGGATCGGTTCTATTAA

Full Affymetrix probeset data:

Annotations for 1640620_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720