FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640621_at:

>probe:Drosophila_2:1640621_at:391:55; Interrogation_Position=2995; Antisense; ATGACCACGTTTGCCTTGGATCTAA
>probe:Drosophila_2:1640621_at:368:57; Interrogation_Position=3019; Antisense; ATGAGAGTGCTTTCCGTCTGCAATA
>probe:Drosophila_2:1640621_at:649:69; Interrogation_Position=3044; Antisense; AGGCATACGCTGGTAGACCCTTCGA
>probe:Drosophila_2:1640621_at:428:451; Interrogation_Position=3067; Antisense; GATCGTGCTCTATCTACCGGAGAGA
>probe:Drosophila_2:1640621_at:556:451; Interrogation_Position=3090; Antisense; GATCTGTATCGGAATCTCAACGGGT
>probe:Drosophila_2:1640621_at:647:497; Interrogation_Position=3141; Antisense; GTCTCAGCCACACTATGACATCTGG
>probe:Drosophila_2:1640621_at:687:315; Interrogation_Position=3210; Antisense; GCCTGGACACATCCATGTGACGCAA
>probe:Drosophila_2:1640621_at:401:399; Interrogation_Position=3237; Antisense; GACAGCCAATATTCTCGAGCAGTTC
>probe:Drosophila_2:1640621_at:17:59; Interrogation_Position=3274; Antisense; ATGTACCGTGGCATGACCTTTGTAA
>probe:Drosophila_2:1640621_at:671:453; Interrogation_Position=3340; Antisense; GATAACTTGAAGTTTTTGCCCTCAA
>probe:Drosophila_2:1640621_at:233:207; Interrogation_Position=3388; Antisense; AAGCGTTTTTCAATCTTGTCCTCTC
>probe:Drosophila_2:1640621_at:322:237; Interrogation_Position=3399; Antisense; AATCTTGTCCTCTCTAGTGCCAGTT
>probe:Drosophila_2:1640621_at:24:507; Interrogation_Position=3415; Antisense; GTGCCAGTTCACAGCCGAAGTACAA
>probe:Drosophila_2:1640621_at:308:17; Interrogation_Position=3481; Antisense; ATTTATATTCTGTACGCTACCTCGT

Paste this into a BLAST search page for me
ATGACCACGTTTGCCTTGGATCTAAATGAGAGTGCTTTCCGTCTGCAATAAGGCATACGCTGGTAGACCCTTCGAGATCGTGCTCTATCTACCGGAGAGAGATCTGTATCGGAATCTCAACGGGTGTCTCAGCCACACTATGACATCTGGGCCTGGACACATCCATGTGACGCAAGACAGCCAATATTCTCGAGCAGTTCATGTACCGTGGCATGACCTTTGTAAGATAACTTGAAGTTTTTGCCCTCAAAAGCGTTTTTCAATCTTGTCCTCTCAATCTTGTCCTCTCTAGTGCCAGTTGTGCCAGTTCACAGCCGAAGTACAAATTTATATTCTGTACGCTACCTCGT

Full Affymetrix probeset data:

Annotations for 1640621_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720