FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640622_at:

>probe:Drosophila_2:1640622_at:594:533; Interrogation_Position=106; Antisense; GGTGTCCTCCTCCTAATAAGTGAGT
>probe:Drosophila_2:1640622_at:71:27; Interrogation_Position=136; Antisense; ATAGCTGTAGCTTCGGTCTGGACAC
>probe:Drosophila_2:1640622_at:525:477; Interrogation_Position=162; Antisense; GTTTAATCGAATCATTGCCGCAGTG
>probe:Drosophila_2:1640622_at:306:705; Interrogation_Position=188; Antisense; TTATGGTATGCTGCTGCATTCGCTT
>probe:Drosophila_2:1640622_at:403:409; Interrogation_Position=19; Antisense; GACGATTCGGATATCTTCGATGAAA
>probe:Drosophila_2:1640622_at:406:483; Interrogation_Position=215; Antisense; GTATACCGCGCACCAAGCAGGAAAT
>probe:Drosophila_2:1640622_at:707:99; Interrogation_Position=230; Antisense; AGCAGGAAATCGAGGCGGACTACCA
>probe:Drosophila_2:1640622_at:680:113; Interrogation_Position=260; Antisense; AGCAGATCACAAAGAAGTTCCGCGA
>probe:Drosophila_2:1640622_at:338:131; Interrogation_Position=326; Antisense; ACCTGCAGAAGGTGTGTGCCCGCAT
>probe:Drosophila_2:1640622_at:631:347; Interrogation_Position=347; Antisense; GCATCCAGAGCGACTATCTCAACTT
>probe:Drosophila_2:1640622_at:186:685; Interrogation_Position=361; Antisense; TATCTCAACTTCCAGGTCAGCATGG
>probe:Drosophila_2:1640622_at:49:171; Interrogation_Position=53; Antisense; AAAGTGTGGTCATAGCGGGCTTCCG
>probe:Drosophila_2:1640622_at:116:121; Interrogation_Position=66; Antisense; AGCGGGCTTCCGAGTGTGGCACATT
>probe:Drosophila_2:1640622_at:77:85; Interrogation_Position=78; Antisense; AGTGTGGCACATTATCGCCGCCGTT

Paste this into a BLAST search page for me
GGTGTCCTCCTCCTAATAAGTGAGTATAGCTGTAGCTTCGGTCTGGACACGTTTAATCGAATCATTGCCGCAGTGTTATGGTATGCTGCTGCATTCGCTTGACGATTCGGATATCTTCGATGAAAGTATACCGCGCACCAAGCAGGAAATAGCAGGAAATCGAGGCGGACTACCAAGCAGATCACAAAGAAGTTCCGCGAACCTGCAGAAGGTGTGTGCCCGCATGCATCCAGAGCGACTATCTCAACTTTATCTCAACTTCCAGGTCAGCATGGAAAGTGTGGTCATAGCGGGCTTCCGAGCGGGCTTCCGAGTGTGGCACATTAGTGTGGCACATTATCGCCGCCGTT

Full Affymetrix probeset data:

Annotations for 1640622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720