FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640623_at:

>probe:Drosophila_2:1640623_at:13:237; Interrogation_Position=1031; Antisense; AATCGTTGAAGAAGAGCACCGCTGT
>probe:Drosophila_2:1640623_at:662:563; Interrogation_Position=1063; Antisense; GGAATGATGCGTATCCACCTGGACA
>probe:Drosophila_2:1640623_at:354:569; Interrogation_Position=556; Antisense; GGCATCTCGTTTCAGCTGCTGCAAA
>probe:Drosophila_2:1640623_at:259:193; Interrogation_Position=580; Antisense; AACTATGTTAGCGACTGCTTTCCGG
>probe:Drosophila_2:1640623_at:249:423; Interrogation_Position=691; Antisense; GAGAAGGACCTGGAGGCCTGCATCA
>probe:Drosophila_2:1640623_at:265:347; Interrogation_Position=710; Antisense; GCATCACCGATCACAAGCATATTCT
>probe:Drosophila_2:1640623_at:150:645; Interrogation_Position=732; Antisense; TCTAGAACTATTCCGACGCATCGAG
>probe:Drosophila_2:1640623_at:520:625; Interrogation_Position=770; Antisense; TGCCCATGCTAATTCAGTTCACAGT
>probe:Drosophila_2:1640623_at:39:155; Interrogation_Position=790; Antisense; ACAGTGACCGCCTTGAATGTGTGCA
>probe:Drosophila_2:1640623_at:32:63; Interrogation_Position=806; Antisense; ATGTGTGCATCGGTTTAGCAGCCCT
>probe:Drosophila_2:1640623_at:467:699; Interrogation_Position=820; Antisense; TTAGCAGCCCTGGTGTTTTTCGTCA
>probe:Drosophila_2:1640623_at:675:415; Interrogation_Position=847; Antisense; GAGCCCATGGCACGGATGTACTTCA
>probe:Drosophila_2:1640623_at:479:157; Interrogation_Position=929; Antisense; ACAACGAGTACTGGTTCGGACGCCT
>probe:Drosophila_2:1640623_at:98:279; Interrogation_Position=957; Antisense; CTACGCGGCCTTCAGTTGCAATTGG

Paste this into a BLAST search page for me
AATCGTTGAAGAAGAGCACCGCTGTGGAATGATGCGTATCCACCTGGACAGGCATCTCGTTTCAGCTGCTGCAAAAACTATGTTAGCGACTGCTTTCCGGGAGAAGGACCTGGAGGCCTGCATCAGCATCACCGATCACAAGCATATTCTTCTAGAACTATTCCGACGCATCGAGTGCCCATGCTAATTCAGTTCACAGTACAGTGACCGCCTTGAATGTGTGCAATGTGTGCATCGGTTTAGCAGCCCTTTAGCAGCCCTGGTGTTTTTCGTCAGAGCCCATGGCACGGATGTACTTCAACAACGAGTACTGGTTCGGACGCCTCTACGCGGCCTTCAGTTGCAATTGG

Full Affymetrix probeset data:

Annotations for 1640623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720