Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640624_s_at:

>probe:Drosophila_2:1640624_s_at:378:573; Interrogation_Position=132; Antisense; GGCGAGAAACTGACCGGCCTGTCGA
>probe:Drosophila_2:1640624_s_at:155:413; Interrogation_Position=143; Antisense; GACCGGCCTGTCGAAAATCTTCAAT
>probe:Drosophila_2:1640624_s_at:138:711; Interrogation_Position=162; Antisense; TTCAATGGCACCACCATGAGCGGCC
>probe:Drosophila_2:1640624_s_at:489:55; Interrogation_Position=177; Antisense; ATGAGCGGCCGTGCAAATGTGGCCA
>probe:Drosophila_2:1640624_s_at:32:523; Interrogation_Position=195; Antisense; GTGGCCAAGGCCACGTACGCCGTGA
>probe:Drosophila_2:1640624_s_at:696:619; Interrogation_Position=226; Antisense; TGCTGATCGCCTACCAGGTGCTGAA
>probe:Drosophila_2:1640624_s_at:727:453; Interrogation_Position=24; Antisense; GATAGACCTCGATAGACTCAGTTGT
>probe:Drosophila_2:1640624_s_at:14:101; Interrogation_Position=265; Antisense; AGAGGGATGCAACTGCTCCAACGCG
>probe:Drosophila_2:1640624_s_at:182:47; Interrogation_Position=300; Antisense; ATCCGCCACAATCGATGTCTTGGAT
>probe:Drosophila_2:1640624_s_at:477:271; Interrogation_Position=332; Antisense; CATCGCTGGACTGCGGATCAGTTTA
>probe:Drosophila_2:1640624_s_at:420:701; Interrogation_Position=357; Antisense; TTTTATGTGTAGTGCAAGACCTTGA
>probe:Drosophila_2:1640624_s_at:241:93; Interrogation_Position=43; Antisense; AGTTGTATAACCTCTGCTCGCAAAT
>probe:Drosophila_2:1640624_s_at:226:697; Interrogation_Position=72; Antisense; TTTACAGGCAACTAGCAGCTCGAAT
>probe:Drosophila_2:1640624_s_at:680:329; Interrogation_Position=89; Antisense; GCTCGAATTCCGTGCAAATAAACCT

Paste this into a BLAST search page for me
GGCGAGAAACTGACCGGCCTGTCGAGACCGGCCTGTCGAAAATCTTCAATTTCAATGGCACCACCATGAGCGGCCATGAGCGGCCGTGCAAATGTGGCCAGTGGCCAAGGCCACGTACGCCGTGATGCTGATCGCCTACCAGGTGCTGAAGATAGACCTCGATAGACTCAGTTGTAGAGGGATGCAACTGCTCCAACGCGATCCGCCACAATCGATGTCTTGGATCATCGCTGGACTGCGGATCAGTTTATTTTATGTGTAGTGCAAGACCTTGAAGTTGTATAACCTCTGCTCGCAAATTTTACAGGCAACTAGCAGCTCGAATGCTCGAATTCCGTGCAAATAAACCT

Full Affymetrix probeset data:

Annotations for 1640624_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime