FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640625_at:

>probe:Drosophila_2:1640625_at:108:679; Interrogation_Position=160; Antisense; TATACGGCCCAAACGAACTTCACGG
>probe:Drosophila_2:1640625_at:233:45; Interrogation_Position=224; Antisense; ATCCCTTCGGATACGGCAACTTTAT
>probe:Drosophila_2:1640625_at:190:435; Interrogation_Position=262; Antisense; GAGGGCTTCCTCGATATCACAAAGT
>probe:Drosophila_2:1640625_at:676:251; Interrogation_Position=281; Antisense; CAAAGTCGGGCTTGAGCTTCGGCGA
>probe:Drosophila_2:1640625_at:704:347; Interrogation_Position=320; Antisense; GCATGTACAAGTGGTCGCGCCGATG
>probe:Drosophila_2:1640625_at:570:45; Interrogation_Position=370; Antisense; ATCCTGGCACTATACAATATCGGCG
>probe:Drosophila_2:1640625_at:300:627; Interrogation_Position=396; Antisense; TGCCGTTGTATTCCGCACAATCGAA
>probe:Drosophila_2:1640625_at:280:167; Interrogation_Position=482; Antisense; AAATGCGTCAGGTTTCCGGCGATCT
>probe:Drosophila_2:1640625_at:536:79; Interrogation_Position=533; Antisense; AGGGTCAGGTGCTGCGCATCATGAA
>probe:Drosophila_2:1640625_at:269:35; Interrogation_Position=579; Antisense; ATCACTATTGCGATCCGGAATGGTA
>probe:Drosophila_2:1640625_at:664:27; Interrogation_Position=608; Antisense; ATACGGATCCGTGGTCCTTCTGGGA
>probe:Drosophila_2:1640625_at:92:593; Interrogation_Position=628; Antisense; TGGGATGCCATGGTCTATTCCGCTA
>probe:Drosophila_2:1640625_at:551:687; Interrogation_Position=643; Antisense; TATTCCGCTACGATTTACACGACCA
>probe:Drosophila_2:1640625_at:602:541; Interrogation_Position=86; Antisense; GGATCAACATCCACAATCTGACCAG

Paste this into a BLAST search page for me
TATACGGCCCAAACGAACTTCACGGATCCCTTCGGATACGGCAACTTTATGAGGGCTTCCTCGATATCACAAAGTCAAAGTCGGGCTTGAGCTTCGGCGAGCATGTACAAGTGGTCGCGCCGATGATCCTGGCACTATACAATATCGGCGTGCCGTTGTATTCCGCACAATCGAAAAATGCGTCAGGTTTCCGGCGATCTAGGGTCAGGTGCTGCGCATCATGAAATCACTATTGCGATCCGGAATGGTAATACGGATCCGTGGTCCTTCTGGGATGGGATGCCATGGTCTATTCCGCTATATTCCGCTACGATTTACACGACCAGGATCAACATCCACAATCTGACCAG

Full Affymetrix probeset data:

Annotations for 1640625_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720