Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640627_at:

>probe:Drosophila_2:1640627_at:410:553; Interrogation_Position=11842; Antisense; GGAGCCGGAACAGCCATACGTTGTA
>probe:Drosophila_2:1640627_at:260:667; Interrogation_Position=11858; Antisense; TACGTTGTAAGCATTTAGAGCCTAG
>probe:Drosophila_2:1640627_at:712:675; Interrogation_Position=11873; Antisense; TAGAGCCTAGAATAACAACCGAACT
>probe:Drosophila_2:1640627_at:511:27; Interrogation_Position=11906; Antisense; ATACACTCGAATCTGTTTCCGTAGC
>probe:Drosophila_2:1640627_at:419:177; Interrogation_Position=11945; Antisense; AAACTGTAGCTGTAGCGTAGGACTA
>probe:Drosophila_2:1640627_at:578:555; Interrogation_Position=11964; Antisense; GGACTAAACTACTTTTATCGGAGCA
>probe:Drosophila_2:1640627_at:668:703; Interrogation_Position=11978; Antisense; TTATCGGAGCAAACCAAGTGCACTT
>probe:Drosophila_2:1640627_at:338:679; Interrogation_Position=12002; Antisense; TAGGCAGCAGGTCATCCCTGTTTAA
>probe:Drosophila_2:1640627_at:432:35; Interrogation_Position=12032; Antisense; ATCAGATCCGGCTGCATCTCACATT
>probe:Drosophila_2:1640627_at:715:717; Interrogation_Position=12056; Antisense; TTCCATTCCAATCCATATGACGGTG
>probe:Drosophila_2:1640627_at:572:149; Interrogation_Position=12274; Antisense; ACTTGTGTGTGATGCTACTTGTGTA
>probe:Drosophila_2:1640627_at:552:515; Interrogation_Position=12294; Antisense; GTGTAATTCTTTACGTTCTAGCAAA
>probe:Drosophila_2:1640627_at:728:471; Interrogation_Position=12332; Antisense; GTTAAACAGTCTAAGGATCCACTAT
>probe:Drosophila_2:1640627_at:483:545; Interrogation_Position=12346; Antisense; GGATCCACTATCTGCTAAGCCAATA

Paste this into a BLAST search page for me
GGAGCCGGAACAGCCATACGTTGTATACGTTGTAAGCATTTAGAGCCTAGTAGAGCCTAGAATAACAACCGAACTATACACTCGAATCTGTTTCCGTAGCAAACTGTAGCTGTAGCGTAGGACTAGGACTAAACTACTTTTATCGGAGCATTATCGGAGCAAACCAAGTGCACTTTAGGCAGCAGGTCATCCCTGTTTAAATCAGATCCGGCTGCATCTCACATTTTCCATTCCAATCCATATGACGGTGACTTGTGTGTGATGCTACTTGTGTAGTGTAATTCTTTACGTTCTAGCAAAGTTAAACAGTCTAAGGATCCACTATGGATCCACTATCTGCTAAGCCAATA

Full Affymetrix probeset data:

Annotations for 1640627_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime