FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640630_at:

>probe:Drosophila_2:1640630_at:671:679; Interrogation_Position=1274; Antisense; TATGTGTTTTACAGGTGATTGAAAC
>probe:Drosophila_2:1640630_at:305:267; Interrogation_Position=1285; Antisense; CAGGTGATTGAAACATTGTGTGAAT
>probe:Drosophila_2:1640630_at:300:509; Interrogation_Position=1304; Antisense; GTGAATATGATACTTAATCTACGAT
>probe:Drosophila_2:1640630_at:151:39; Interrogation_Position=1320; Antisense; ATCTACGATTATGTCATCTCCACTG
>probe:Drosophila_2:1640630_at:33:139; Interrogation_Position=1324; Antisense; ACGATTATGTCATCTCCACTGTACA
>probe:Drosophila_2:1640630_at:215:461; Interrogation_Position=1326; Antisense; GATTATGTCATCTCCACTGTACACT
>probe:Drosophila_2:1640630_at:345:681; Interrogation_Position=1329; Antisense; TATGTCATCTCCACTGTACACTTAT
>probe:Drosophila_2:1640630_at:165:271; Interrogation_Position=1334; Antisense; CATCTCCACTGTACACTTATCATTA
>probe:Drosophila_2:1640630_at:303:259; Interrogation_Position=1340; Antisense; CACTGTACACTTATCATTATTGCTG
>probe:Drosophila_2:1640630_at:378:37; Interrogation_Position=1352; Antisense; ATCATTATTGCTGTGCTGTTTTCCA
>probe:Drosophila_2:1640630_at:320:703; Interrogation_Position=1356; Antisense; TTATTGCTGTGCTGTTTTCCATTTC
>probe:Drosophila_2:1640630_at:682:7; Interrogation_Position=1358; Antisense; ATTGCTGTGCTGTTTTCCATTTCTC
>probe:Drosophila_2:1640630_at:525:601; Interrogation_Position=1368; Antisense; TGTTTTCCATTTCTCCCCAGGCATT
>probe:Drosophila_2:1640630_at:588:271; Interrogation_Position=1375; Antisense; CATTTCTCCCCAGGCATTCGAGGGA

Paste this into a BLAST search page for me
TATGTGTTTTACAGGTGATTGAAACCAGGTGATTGAAACATTGTGTGAATGTGAATATGATACTTAATCTACGATATCTACGATTATGTCATCTCCACTGACGATTATGTCATCTCCACTGTACAGATTATGTCATCTCCACTGTACACTTATGTCATCTCCACTGTACACTTATCATCTCCACTGTACACTTATCATTACACTGTACACTTATCATTATTGCTGATCATTATTGCTGTGCTGTTTTCCATTATTGCTGTGCTGTTTTCCATTTCATTGCTGTGCTGTTTTCCATTTCTCTGTTTTCCATTTCTCCCCAGGCATTCATTTCTCCCCAGGCATTCGAGGGA

Full Affymetrix probeset data:

Annotations for 1640630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720