FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640632_at:

>probe:Drosophila_2:1640632_at:170:323; Interrogation_Position=1036; Antisense; GCGCTGCACAAGTAGGGCCCAAGTC
>probe:Drosophila_2:1640632_at:639:283; Interrogation_Position=1081; Antisense; CTGCTGTCCTTAACCAGTGAGCTAA
>probe:Drosophila_2:1640632_at:196:513; Interrogation_Position=1097; Antisense; GTGAGCTAAGCCTCCGAAAATGTGT
>probe:Drosophila_2:1640632_at:682:387; Interrogation_Position=1112; Antisense; GAAAATGTGTATTGGAGACTCCTCC
>probe:Drosophila_2:1640632_at:559:483; Interrogation_Position=1178; Antisense; GTATCCGACACTTGTTATTACAGTT
>probe:Drosophila_2:1640632_at:601:221; Interrogation_Position=676; Antisense; AAGGGCAAGGCCCAGTACCTGCAGT
>probe:Drosophila_2:1640632_at:410:87; Interrogation_Position=698; Antisense; AGTCCGTCGAGGATCGCTCCAAGTT
>probe:Drosophila_2:1640632_at:556:317; Interrogation_Position=713; Antisense; GCTCCAAGTTGGACGGCCTGTACGA
>probe:Drosophila_2:1640632_at:18:639; Interrogation_Position=775; Antisense; TCGTACTGGTGGAACGCCGAGAAGT
>probe:Drosophila_2:1640632_at:176:335; Interrogation_Position=816; Antisense; GCTGATGCAGGCCTACCGCTGGATC
>probe:Drosophila_2:1640632_at:105:333; Interrogation_Position=833; Antisense; GCTGGATCATCGACTCGCGTGACGA
>probe:Drosophila_2:1640632_at:8:109; Interrogation_Position=857; Antisense; AGAACTCCGCCGAGCGTCTGAACAA
>probe:Drosophila_2:1640632_at:647:499; Interrogation_Position=872; Antisense; GTCTGAACAAGTTGAAGGACCCCTT
>probe:Drosophila_2:1640632_at:199:645; Interrogation_Position=902; Antisense; TCTACCGGTGCCACACGATCATGAA

Paste this into a BLAST search page for me
GCGCTGCACAAGTAGGGCCCAAGTCCTGCTGTCCTTAACCAGTGAGCTAAGTGAGCTAAGCCTCCGAAAATGTGTGAAAATGTGTATTGGAGACTCCTCCGTATCCGACACTTGTTATTACAGTTAAGGGCAAGGCCCAGTACCTGCAGTAGTCCGTCGAGGATCGCTCCAAGTTGCTCCAAGTTGGACGGCCTGTACGATCGTACTGGTGGAACGCCGAGAAGTGCTGATGCAGGCCTACCGCTGGATCGCTGGATCATCGACTCGCGTGACGAAGAACTCCGCCGAGCGTCTGAACAAGTCTGAACAAGTTGAAGGACCCCTTTCTACCGGTGCCACACGATCATGAA

Full Affymetrix probeset data:

Annotations for 1640632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720