FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640636_at:

>probe:Drosophila_2:1640636_at:538:295; Interrogation_Position=4118; Antisense; CGAAAAGATTCGATCCGCACAAGAA
>probe:Drosophila_2:1640636_at:370:451; Interrogation_Position=4149; Antisense; GATCGATACGACGAACAAGTGTTAT
>probe:Drosophila_2:1640636_at:313:321; Interrogation_Position=4188; Antisense; GCCCAGGTATCCACTGGTGGCCACA
>probe:Drosophila_2:1640636_at:587:323; Interrogation_Position=4230; Antisense; GCGCGAGAAGATCGTCTATTCGGAT
>probe:Drosophila_2:1640636_at:105:575; Interrogation_Position=4333; Antisense; GGCGAGGAGTGCAGCTCCACCAGCA
>probe:Drosophila_2:1640636_at:65:523; Interrogation_Position=4387; Antisense; GTGGCCATGGTCACCAAGGCTGGTA
>probe:Drosophila_2:1640636_at:293:227; Interrogation_Position=4402; Antisense; AAGGCTGGTAGCTCCAATGCCACAA
>probe:Drosophila_2:1640636_at:95:235; Interrogation_Position=4417; Antisense; AATGCCACAACGGTGCTGGATTCAT
>probe:Drosophila_2:1640636_at:374:287; Interrogation_Position=4432; Antisense; CTGGATTCATCCAATTCCAGCGGCT
>probe:Drosophila_2:1640636_at:74:245; Interrogation_Position=4444; Antisense; AATTCCAGCGGCTCAAATGCCGGAA
>probe:Drosophila_2:1640636_at:685:157; Interrogation_Position=4468; Antisense; ACACTGAGTGTTCCCAGTGCTGGTA
>probe:Drosophila_2:1640636_at:420:45; Interrogation_Position=4537; Antisense; ATCCGGATGAGCACCTGCAGCAATG
>probe:Drosophila_2:1640636_at:480:249; Interrogation_Position=4557; Antisense; CAATGATTCCGGATTCGAAGGCGGC
>probe:Drosophila_2:1640636_at:564:321; Interrogation_Position=4587; Antisense; GCCCTCCAGTCCCAAGAAGATGTTA

Paste this into a BLAST search page for me
CGAAAAGATTCGATCCGCACAAGAAGATCGATACGACGAACAAGTGTTATGCCCAGGTATCCACTGGTGGCCACAGCGCGAGAAGATCGTCTATTCGGATGGCGAGGAGTGCAGCTCCACCAGCAGTGGCCATGGTCACCAAGGCTGGTAAAGGCTGGTAGCTCCAATGCCACAAAATGCCACAACGGTGCTGGATTCATCTGGATTCATCCAATTCCAGCGGCTAATTCCAGCGGCTCAAATGCCGGAAACACTGAGTGTTCCCAGTGCTGGTAATCCGGATGAGCACCTGCAGCAATGCAATGATTCCGGATTCGAAGGCGGCGCCCTCCAGTCCCAAGAAGATGTTA

Full Affymetrix probeset data:

Annotations for 1640636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720