Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640637_at:

>probe:Drosophila_2:1640637_at:172:189; Interrogation_Position=1205; Antisense; AACAGCAGATGTCAAGTGGCGGTCT
>probe:Drosophila_2:1640637_at:719:283; Interrogation_Position=1228; Antisense; CTGCTGGGATCTGTGCTGGGCACTA
>probe:Drosophila_2:1640637_at:666:639; Interrogation_Position=1304; Antisense; TCGGTGGGAGTCTGCTTATGTCGCA
>probe:Drosophila_2:1640637_at:186:277; Interrogation_Position=1318; Antisense; CTTATGTCGCAGTTTTAGGCAGGAT
>probe:Drosophila_2:1640637_at:360:241; Interrogation_Position=1353; Antisense; AATAGACTTGGCTCATTACCTCTCA
>probe:Drosophila_2:1640637_at:619:103; Interrogation_Position=1383; Antisense; AGACGCACCCCAAATGGCAACATAA
>probe:Drosophila_2:1640637_at:463:503; Interrogation_Position=1428; Antisense; GTCCTCTACATGCAATTTTCTCGAT
>probe:Drosophila_2:1640637_at:425:293; Interrogation_Position=1449; Antisense; CGATATCGTTTCGTGTCCTAGTTAT
>probe:Drosophila_2:1640637_at:155:717; Interrogation_Position=1535; Antisense; TTCGTTTTCGCGCTAGCTTAATGAG
>probe:Drosophila_2:1640637_at:624:133; Interrogation_Position=1589; Antisense; ACGCAAGAACGTTTTCGCTCTCGAT
>probe:Drosophila_2:1640637_at:54:183; Interrogation_Position=1661; Antisense; AAAACGCTGCTTTGCAACCTCTTTA
>probe:Drosophila_2:1640637_at:251:607; Interrogation_Position=1689; Antisense; TGCTTACCAACCTTGTAACGTGTGT
>probe:Drosophila_2:1640637_at:236:139; Interrogation_Position=1706; Antisense; ACGTGTGTAGGGTCAGTATTTCAAT
>probe:Drosophila_2:1640637_at:378:361; Interrogation_Position=1740; Antisense; GCAATGGTTTGTTCTTCCAGCAAGT

Paste this into a BLAST search page for me
AACAGCAGATGTCAAGTGGCGGTCTCTGCTGGGATCTGTGCTGGGCACTATCGGTGGGAGTCTGCTTATGTCGCACTTATGTCGCAGTTTTAGGCAGGATAATAGACTTGGCTCATTACCTCTCAAGACGCACCCCAAATGGCAACATAAGTCCTCTACATGCAATTTTCTCGATCGATATCGTTTCGTGTCCTAGTTATTTCGTTTTCGCGCTAGCTTAATGAGACGCAAGAACGTTTTCGCTCTCGATAAAACGCTGCTTTGCAACCTCTTTATGCTTACCAACCTTGTAACGTGTGTACGTGTGTAGGGTCAGTATTTCAATGCAATGGTTTGTTCTTCCAGCAAGT

Full Affymetrix probeset data:

Annotations for 1640637_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime