FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640638_at:

>probe:Drosophila_2:1640638_at:525:357; Interrogation_Position=1010; Antisense; GCAAATTGGAAATTCCGCTGCCCAA
>probe:Drosophila_2:1640638_at:128:373; Interrogation_Position=1036; Antisense; GAAGTGGCGCGTATGGACATTCTTA
>probe:Drosophila_2:1640638_at:380:11; Interrogation_Position=1054; Antisense; ATTCTTAAGATTCACGCCGAACCAC
>probe:Drosophila_2:1640638_at:501:659; Interrogation_Position=1116; Antisense; TAAGCTCTCCGATTTGTTCAATGGT
>probe:Drosophila_2:1640638_at:592:227; Interrogation_Position=1135; Antisense; AATGGTGCCGATCTACGGAACATTT
>probe:Drosophila_2:1640638_at:350:151; Interrogation_Position=1154; Antisense; ACATTTGCACGGAAGCCGGGCTTTT
>probe:Drosophila_2:1640638_at:728:95; Interrogation_Position=1215; Antisense; AGATTTCATGAAGGCCGTCCGCAAA
>probe:Drosophila_2:1640638_at:349:121; Interrogation_Position=1256; Antisense; AGCTGGAGTCTCGTCTGGACTACAA
>probe:Drosophila_2:1640638_at:510:97; Interrogation_Position=821; Antisense; AGATCGACGCAATCGGTGGTCGCCG
>probe:Drosophila_2:1640638_at:540:535; Interrogation_Position=838; Antisense; GGTCGCCGCTTCTCGGAGGGAACAT
>probe:Drosophila_2:1640638_at:660:261; Interrogation_Position=880; Antisense; CAGCGCACGCTGATGGAACTGCTTA
>probe:Drosophila_2:1640638_at:463:9; Interrogation_Position=918; Antisense; ATTCGATGCTCTTGGCCAGGTGAAA
>probe:Drosophila_2:1640638_at:651:543; Interrogation_Position=966; Antisense; GGATACACTGGATCCGGCGCTGCTG
>probe:Drosophila_2:1640638_at:191:505; Interrogation_Position=992; Antisense; GTCCTGGACGACTTGATCGCAAATT

Paste this into a BLAST search page for me
GCAAATTGGAAATTCCGCTGCCCAAGAAGTGGCGCGTATGGACATTCTTAATTCTTAAGATTCACGCCGAACCACTAAGCTCTCCGATTTGTTCAATGGTAATGGTGCCGATCTACGGAACATTTACATTTGCACGGAAGCCGGGCTTTTAGATTTCATGAAGGCCGTCCGCAAAAGCTGGAGTCTCGTCTGGACTACAAAGATCGACGCAATCGGTGGTCGCCGGGTCGCCGCTTCTCGGAGGGAACATCAGCGCACGCTGATGGAACTGCTTAATTCGATGCTCTTGGCCAGGTGAAAGGATACACTGGATCCGGCGCTGCTGGTCCTGGACGACTTGATCGCAAATT

Full Affymetrix probeset data:

Annotations for 1640638_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720