FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640639_at:

>probe:Drosophila_2:1640639_at:63:713; Interrogation_Position=1022; Antisense; TTGCCAACATAACAGGTTCCTTCCG
>probe:Drosophila_2:1640639_at:530:205; Interrogation_Position=1054; Antisense; AAGCTGCCAGTTTCCGTGGACAATT
>probe:Drosophila_2:1640639_at:394:7; Interrogation_Position=554; Antisense; ATTGCGATCCCATGTCTACAGGACT
>probe:Drosophila_2:1640639_at:26:153; Interrogation_Position=571; Antisense; ACAGGACTTGCAGGACGTCGGGACC
>probe:Drosophila_2:1640639_at:682:555; Interrogation_Position=649; Antisense; GGACTCTTTGTCTCAGCTGTGTTTA
>probe:Drosophila_2:1640639_at:499:699; Interrogation_Position=670; Antisense; TTTAGCGCGGCCTTGAGCTCGTTAT
>probe:Drosophila_2:1640639_at:385:641; Interrogation_Position=711; Antisense; TCTGGCCGCTGTTATCCTGGAGGAC
>probe:Drosophila_2:1640639_at:514:703; Interrogation_Position=740; Antisense; TTAGGCCGCGCATGGGAAAATCGAT
>probe:Drosophila_2:1640639_at:393:225; Interrogation_Position=766; Antisense; AAGGAGAACCACGTGGCTCTGACCA
>probe:Drosophila_2:1640639_at:52:533; Interrogation_Position=801; Antisense; GGTGGTAACCTTTGGCATAAGCTCA
>probe:Drosophila_2:1640639_at:445:5; Interrogation_Position=870; Antisense; ATTGTCGGCGACACTTCAGTCAAGT
>probe:Drosophila_2:1640639_at:359:65; Interrogation_Position=899; Antisense; ATGGACCGATGTTGGGCATTTTCAC
>probe:Drosophila_2:1640639_at:248:507; Interrogation_Position=957; Antisense; GTGCGTTTTCATAGGCAGCGTTGCC
>probe:Drosophila_2:1640639_at:317:281; Interrogation_Position=981; Antisense; CTCCTTTTTGACCATGGCCTGGATA

Paste this into a BLAST search page for me
TTGCCAACATAACAGGTTCCTTCCGAAGCTGCCAGTTTCCGTGGACAATTATTGCGATCCCATGTCTACAGGACTACAGGACTTGCAGGACGTCGGGACCGGACTCTTTGTCTCAGCTGTGTTTATTTAGCGCGGCCTTGAGCTCGTTATTCTGGCCGCTGTTATCCTGGAGGACTTAGGCCGCGCATGGGAAAATCGATAAGGAGAACCACGTGGCTCTGACCAGGTGGTAACCTTTGGCATAAGCTCAATTGTCGGCGACACTTCAGTCAAGTATGGACCGATGTTGGGCATTTTCACGTGCGTTTTCATAGGCAGCGTTGCCCTCCTTTTTGACCATGGCCTGGATA

Full Affymetrix probeset data:

Annotations for 1640639_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720