Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640640_at:

>probe:Drosophila_2:1640640_at:590:443; Interrogation_Position=6283; Antisense; GATGATTACCATATATGTCGTACAT
>probe:Drosophila_2:1640640_at:680:671; Interrogation_Position=6307; Antisense; TACCAAGCCAAGGAAGCTCCGTGGG
>probe:Drosophila_2:1640640_at:8:119; Interrogation_Position=6344; Antisense; AGCTCGATCCCATTTGATCTGATCC
>probe:Drosophila_2:1640640_at:210:629; Interrogation_Position=6376; Antisense; TCCGATCCGATCAGCAAGTTAAACT
>probe:Drosophila_2:1640640_at:332:179; Interrogation_Position=6396; Antisense; AAACTTGAACGAAACATTAGCACAC
>probe:Drosophila_2:1640640_at:581:91; Interrogation_Position=6430; Antisense; AGTTAGTAACTAAGCACCCGCAGCA
>probe:Drosophila_2:1640640_at:111:303; Interrogation_Position=6447; Antisense; CCGCAGCATGCCACACATAAAGTGT
>probe:Drosophila_2:1640640_at:217:5; Interrogation_Position=6476; Antisense; ATTGGTTCGGAAATCGCGTGTTTGA
>probe:Drosophila_2:1640640_at:478:723; Interrogation_Position=6525; Antisense; TTGAATGTATAGTGTTGCGCCTCCT
>probe:Drosophila_2:1640640_at:359:623; Interrogation_Position=6540; Antisense; TGCGCCTCCTAGAACTTTACTTATA
>probe:Drosophila_2:1640640_at:113:483; Interrogation_Position=6607; Antisense; GTATATTGACGATGCAAGCCATTGC
>probe:Drosophila_2:1640640_at:130:703; Interrogation_Position=6642; Antisense; TTTTGTCGCCACATTCTCGCGAAAT
>probe:Drosophila_2:1640640_at:635:319; Interrogation_Position=6660; Antisense; GCGAAATTGATTCTAGACCTAGGCA
>probe:Drosophila_2:1640640_at:383:129; Interrogation_Position=6735; Antisense; ACCAGACGCCCAAATCAAAGTTCAT

Paste this into a BLAST search page for me
GATGATTACCATATATGTCGTACATTACCAAGCCAAGGAAGCTCCGTGGGAGCTCGATCCCATTTGATCTGATCCTCCGATCCGATCAGCAAGTTAAACTAAACTTGAACGAAACATTAGCACACAGTTAGTAACTAAGCACCCGCAGCACCGCAGCATGCCACACATAAAGTGTATTGGTTCGGAAATCGCGTGTTTGATTGAATGTATAGTGTTGCGCCTCCTTGCGCCTCCTAGAACTTTACTTATAGTATATTGACGATGCAAGCCATTGCTTTTGTCGCCACATTCTCGCGAAATGCGAAATTGATTCTAGACCTAGGCAACCAGACGCCCAAATCAAAGTTCAT

Full Affymetrix probeset data:

Annotations for 1640640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime