FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640642_at:

>probe:Drosophila_2:1640642_at:625:23; Interrogation_Position=1034; Antisense; ATATCGCTGTGGTTCTTCGCCTGGA
>probe:Drosophila_2:1640642_at:206:557; Interrogation_Position=1056; Antisense; GGACTCCGTATACCATCATCAACTA
>probe:Drosophila_2:1640642_at:141:193; Interrogation_Position=1076; Antisense; AACTACGCGGGCATCTTCGAATCGA
>probe:Drosophila_2:1640642_at:284:367; Interrogation_Position=1094; Antisense; GAATCGATGCACCTGAGTCCACTGA
>probe:Drosophila_2:1640642_at:451:609; Interrogation_Position=1116; Antisense; TGAGCACCATCTGTGGATCCGTCTT
>probe:Drosophila_2:1640642_at:270:497; Interrogation_Position=1136; Antisense; GTCTTTGCCAAAGCCAATGCCGTGT
>probe:Drosophila_2:1640642_at:122:235; Interrogation_Position=1151; Antisense; AATGCCGTGTGCAATCCCATTGTGT
>probe:Drosophila_2:1640642_at:503:135; Interrogation_Position=1176; Antisense; ACGGATTGAGCCACCCGAAGTACAA
>probe:Drosophila_2:1640642_at:404:669; Interrogation_Position=1209; Antisense; TACGGGAGAAGATGCCATGCCTGGC
>probe:Drosophila_2:1640642_at:290:331; Interrogation_Position=1236; Antisense; GCGGCAAGGACGATCTCACCTCGGA
>probe:Drosophila_2:1640642_at:154:67; Interrogation_Position=1272; Antisense; AGGCCACCGCCGAGATTAGCGAATC
>probe:Drosophila_2:1640642_at:243:527; Interrogation_Position=1339; Antisense; GGGAACTGACAGCTCTAGATCTACA
>probe:Drosophila_2:1640642_at:534:713; Interrogation_Position=900; Antisense; TTCAGGCTGTGGCTGCCCATGAGAA
>probe:Drosophila_2:1640642_at:259:109; Interrogation_Position=945; Antisense; AGAAGATGAACGTGGCCTCCTTGCG

Paste this into a BLAST search page for me
ATATCGCTGTGGTTCTTCGCCTGGAGGACTCCGTATACCATCATCAACTAAACTACGCGGGCATCTTCGAATCGAGAATCGATGCACCTGAGTCCACTGATGAGCACCATCTGTGGATCCGTCTTGTCTTTGCCAAAGCCAATGCCGTGTAATGCCGTGTGCAATCCCATTGTGTACGGATTGAGCCACCCGAAGTACAATACGGGAGAAGATGCCATGCCTGGCGCGGCAAGGACGATCTCACCTCGGAAGGCCACCGCCGAGATTAGCGAATCGGGAACTGACAGCTCTAGATCTACATTCAGGCTGTGGCTGCCCATGAGAAAGAAGATGAACGTGGCCTCCTTGCG

Full Affymetrix probeset data:

Annotations for 1640642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720