FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640644_at:

>probe:Drosophila_2:1640644_at:481:531; Interrogation_Position=1042; Antisense; GGGTCGCATCATACCCGGCTATTAA
>probe:Drosophila_2:1640644_at:286:673; Interrogation_Position=1053; Antisense; TACCCGGCTATTAACTATGCTTACT
>probe:Drosophila_2:1640644_at:345:51; Interrogation_Position=1069; Antisense; ATGCTTACTATAGCCCTTAAGTGTA
>probe:Drosophila_2:1640644_at:481:73; Interrogation_Position=585; Antisense; AGGAACAGATCCAGCCGGTCAAGGT
>probe:Drosophila_2:1640644_at:271:405; Interrogation_Position=607; Antisense; GGTGCAACCGGTTTACAACCAGGAG
>probe:Drosophila_2:1640644_at:442:67; Interrogation_Position=630; Antisense; AGGCCAAGATCGTCTACTCCAAGGT
>probe:Drosophila_2:1640644_at:558:403; Interrogation_Position=656; Antisense; GACTTTGCCGCCAATCCTGGAGGCA
>probe:Drosophila_2:1640644_at:458:373; Interrogation_Position=688; Antisense; GAAGTCTCACCAAAACCCCAAGGAG
>probe:Drosophila_2:1640644_at:713:107; Interrogation_Position=738; Antisense; AGAAGCACCTAACCGAACTGCGCGA
>probe:Drosophila_2:1640644_at:459:331; Interrogation_Position=785; Antisense; GCGGAGATCCAGACGGACATCGCCT
>probe:Drosophila_2:1640644_at:687:323; Interrogation_Position=811; Antisense; GCGCAACGCATTCGACAAGGTCGAG
>probe:Drosophila_2:1640644_at:536:225; Interrogation_Position=848; Antisense; AAGGACGACACCAAGCTGCTGCAAA
>probe:Drosophila_2:1640644_at:583:169; Interrogation_Position=871; Antisense; AAAGGCCATCAAGAAGCGGCGCGTG
>probe:Drosophila_2:1640644_at:649:101; Interrogation_Position=912; Antisense; AGACCAAGTGGACTGAACGCAAGCA

Paste this into a BLAST search page for me
GGGTCGCATCATACCCGGCTATTAATACCCGGCTATTAACTATGCTTACTATGCTTACTATAGCCCTTAAGTGTAAGGAACAGATCCAGCCGGTCAAGGTGGTGCAACCGGTTTACAACCAGGAGAGGCCAAGATCGTCTACTCCAAGGTGACTTTGCCGCCAATCCTGGAGGCAGAAGTCTCACCAAAACCCCAAGGAGAGAAGCACCTAACCGAACTGCGCGAGCGGAGATCCAGACGGACATCGCCTGCGCAACGCATTCGACAAGGTCGAGAAGGACGACACCAAGCTGCTGCAAAAAAGGCCATCAAGAAGCGGCGCGTGAGACCAAGTGGACTGAACGCAAGCA

Full Affymetrix probeset data:

Annotations for 1640644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720