Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640647_s_at:

>probe:Drosophila_2:1640647_s_at:590:235; Interrogation_Position=263; Antisense; AATCCGATCAAGTTTATGGCTGTGC
>probe:Drosophila_2:1640647_s_at:502:573; Interrogation_Position=280; Antisense; GGCTGTGCATCCAATATTGATCACT
>probe:Drosophila_2:1640647_s_at:169:5; Interrogation_Position=295; Antisense; ATTGATCACTCCATGGACTACTACT
>probe:Drosophila_2:1640647_s_at:378:569; Interrogation_Position=329; Antisense; GGCATAAACTCTTCGCCCGAAAAGT
>probe:Drosophila_2:1640647_s_at:461:177; Interrogation_Position=370; Antisense; AAACGTGAAACGACCGAGCTGAACA
>probe:Drosophila_2:1640647_s_at:467:317; Interrogation_Position=417; Antisense; GAACTGGGTTCGCAATTGGGCCTTA
>probe:Drosophila_2:1640647_s_at:138:579; Interrogation_Position=435; Antisense; GGCCTTAAAGTTCGGCGTTGATTTG
>probe:Drosophila_2:1640647_s_at:99:211; Interrogation_Position=549; Antisense; AAGAACAAGGATCCTGGCGGGACAA
>probe:Drosophila_2:1640647_s_at:574:205; Interrogation_Position=611; Antisense; AAGCGACAGGATTCGGAGCCAGAAA
>probe:Drosophila_2:1640647_s_at:108:163; Interrogation_Position=654; Antisense; AAATTTGCTGGCTGTGACTGTCATT
>probe:Drosophila_2:1640647_s_at:722:635; Interrogation_Position=719; Antisense; TCGCACGTCGCTTACAATGGCAAAA
>probe:Drosophila_2:1640647_s_at:532:231; Interrogation_Position=744; Antisense; AATGAAAACCTACGCCCAGATTGAA
>probe:Drosophila_2:1640647_s_at:399:481; Interrogation_Position=780; Antisense; GTATTCGCCGCGTTGTACGTTTGGC
>probe:Drosophila_2:1640647_s_at:328:65; Interrogation_Position=809; Antisense; ATGGTCCGTGGCTATATGTGCGGTT

Paste this into a BLAST search page for me
AATCCGATCAAGTTTATGGCTGTGCGGCTGTGCATCCAATATTGATCACTATTGATCACTCCATGGACTACTACTGGCATAAACTCTTCGCCCGAAAAGTAAACGTGAAACGACCGAGCTGAACAGAACTGGGTTCGCAATTGGGCCTTAGGCCTTAAAGTTCGGCGTTGATTTGAAGAACAAGGATCCTGGCGGGACAAAAGCGACAGGATTCGGAGCCAGAAAAAATTTGCTGGCTGTGACTGTCATTTCGCACGTCGCTTACAATGGCAAAAAATGAAAACCTACGCCCAGATTGAAGTATTCGCCGCGTTGTACGTTTGGCATGGTCCGTGGCTATATGTGCGGTT

Full Affymetrix probeset data:

Annotations for 1640647_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime