Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640649_at:

>probe:Drosophila_2:1640649_at:468:545; Interrogation_Position=1059; Antisense; GGATCTCCACGCGAGAAAGCGACAT
>probe:Drosophila_2:1640649_at:656:493; Interrogation_Position=1102; Antisense; GTCAAAGTCCAAGAGCTCAATCCTA
>probe:Drosophila_2:1640649_at:480:233; Interrogation_Position=1120; Antisense; AATCCTAAGCGAACACTTGCCGGTG
>probe:Drosophila_2:1640649_at:104:123; Interrogation_Position=1176; Antisense; AGCGCATCGAACTGGTTTTGGCATC
>probe:Drosophila_2:1640649_at:609:701; Interrogation_Position=1191; Antisense; TTTTGGCATCCACACGATTCTACTA
>probe:Drosophila_2:1640649_at:240:95; Interrogation_Position=1218; Antisense; AGTTGGGAGAGTTCGCCTGGCTCTA
>probe:Drosophila_2:1640649_at:694:645; Interrogation_Position=1278; Antisense; TCTTCTGGCCCATACAGAGCAACTA
>probe:Drosophila_2:1640649_at:605:575; Interrogation_Position=1323; Antisense; GGCGCACTCCGTACGACATAAATCT
>probe:Drosophila_2:1640649_at:296:651; Interrogation_Position=1347; Antisense; TCACATTTGGTGAGTATGCCGCGGA
>probe:Drosophila_2:1640649_at:534:213; Interrogation_Position=1443; Antisense; AAGAGACCCCGCCAAAGACAGAATA
>probe:Drosophila_2:1640649_at:385:203; Interrogation_Position=1497; Antisense; AACCTTAGATTTTGTGTCCATTGTA
>probe:Drosophila_2:1640649_at:413:503; Interrogation_Position=1512; Antisense; GTCCATTGTATTTTCTAAACCGTCA
>probe:Drosophila_2:1640649_at:59:13; Interrogation_Position=1553; Antisense; ATTCTAAAGAATTCGCGCCTCAGCA
>probe:Drosophila_2:1640649_at:670:633; Interrogation_Position=1565; Antisense; TCGCGCCTCAGCAAGTATGTTTGTT

Paste this into a BLAST search page for me
GGATCTCCACGCGAGAAAGCGACATGTCAAAGTCCAAGAGCTCAATCCTAAATCCTAAGCGAACACTTGCCGGTGAGCGCATCGAACTGGTTTTGGCATCTTTTGGCATCCACACGATTCTACTAAGTTGGGAGAGTTCGCCTGGCTCTATCTTCTGGCCCATACAGAGCAACTAGGCGCACTCCGTACGACATAAATCTTCACATTTGGTGAGTATGCCGCGGAAAGAGACCCCGCCAAAGACAGAATAAACCTTAGATTTTGTGTCCATTGTAGTCCATTGTATTTTCTAAACCGTCAATTCTAAAGAATTCGCGCCTCAGCATCGCGCCTCAGCAAGTATGTTTGTT

Full Affymetrix probeset data:

Annotations for 1640649_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime