FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640650_at:

>probe:Drosophila_2:1640650_at:637:629; Interrogation_Position=2435; Antisense; TCCTCTGGTCCTCGTTGTAGGCAAG
>probe:Drosophila_2:1640650_at:385:249; Interrogation_Position=2456; Antisense; CAAGGACTACGGCAGCGGAAGCTCT
>probe:Drosophila_2:1640650_at:587:377; Interrogation_Position=2473; Antisense; GAAGCTCTCGGGATTGGGCCGCCAA
>probe:Drosophila_2:1640650_at:374:653; Interrogation_Position=2518; Antisense; TCAAGGCGGTGATCGCGGAGTCCTA
>probe:Drosophila_2:1640650_at:19:551; Interrogation_Position=2534; Antisense; GGAGTCCTACGAGCGCATTCATCGT
>probe:Drosophila_2:1640650_at:42:13; Interrogation_Position=2550; Antisense; ATTCATCGTTCCAACCTGGTGGGCA
>probe:Drosophila_2:1640650_at:482:245; Interrogation_Position=2593; Antisense; AATTCCTGCCGGGACAGAGTGCCGA
>probe:Drosophila_2:1640650_at:383:105; Interrogation_Position=2617; Antisense; AGACATTGAACCTGACTGGCCGGGA
>probe:Drosophila_2:1640650_at:599:661; Interrogation_Position=2674; Antisense; TAAAGCCGGGCCAGAAGATCCAAGT
>probe:Drosophila_2:1640650_at:250:71; Interrogation_Position=2701; Antisense; AGGCTGATGGCACCGTCTTTGAGAC
>probe:Drosophila_2:1640650_at:525:691; Interrogation_Position=2718; Antisense; TTTGAGACTATTCTGCGCTTCGACA
>probe:Drosophila_2:1640650_at:302:65; Interrogation_Position=2770; Antisense; ATGGTGGAATCCTCAACTACATGAT
>probe:Drosophila_2:1640650_at:223:665; Interrogation_Position=2892; Antisense; TAAATTGTGGTGGTGCTTCCCCAAC
>probe:Drosophila_2:1640650_at:40:493; Interrogation_Position=2934; Antisense; GTAAGCCCTTATTCTTGGTATCTAA

Paste this into a BLAST search page for me
TCCTCTGGTCCTCGTTGTAGGCAAGCAAGGACTACGGCAGCGGAAGCTCTGAAGCTCTCGGGATTGGGCCGCCAATCAAGGCGGTGATCGCGGAGTCCTAGGAGTCCTACGAGCGCATTCATCGTATTCATCGTTCCAACCTGGTGGGCAAATTCCTGCCGGGACAGAGTGCCGAAGACATTGAACCTGACTGGCCGGGATAAAGCCGGGCCAGAAGATCCAAGTAGGCTGATGGCACCGTCTTTGAGACTTTGAGACTATTCTGCGCTTCGACAATGGTGGAATCCTCAACTACATGATTAAATTGTGGTGGTGCTTCCCCAACGTAAGCCCTTATTCTTGGTATCTAA

Full Affymetrix probeset data:

Annotations for 1640650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720