FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640652_at:

>probe:Drosophila_2:1640652_at:158:323; Interrogation_Position=112; Antisense; GCCCACGAGTCACGATGCGAATTTA
>probe:Drosophila_2:1640652_at:688:615; Interrogation_Position=127; Antisense; TGCGAATTTAGCCACCTGCAAAACC
>probe:Drosophila_2:1640652_at:533:525; Interrogation_Position=217; Antisense; GGGCACCTCTATTTGCTATACTATC
>probe:Drosophila_2:1640652_at:218:667; Interrogation_Position=312; Antisense; TACTTCCCTGCAACAAGTTGGCCAT
>probe:Drosophila_2:1640652_at:375:95; Interrogation_Position=327; Antisense; AGTTGGCCATCATAGCCTCTATTTT
>probe:Drosophila_2:1640652_at:118:129; Interrogation_Position=412; Antisense; ACCGGGATCTGCAGCGGATACGATA
>probe:Drosophila_2:1640652_at:656:455; Interrogation_Position=428; Antisense; GATACGATATTCTACAGGTCCTGGA
>probe:Drosophila_2:1640652_at:638:213; Interrogation_Position=452; Antisense; AAGTTGCAGCAATTCGTGGTTTTCG
>probe:Drosophila_2:1640652_at:365:517; Interrogation_Position=467; Antisense; GTGGTTTTCGCGAAGGAGCTATCCG
>probe:Drosophila_2:1640652_at:633:215; Interrogation_Position=525; Antisense; AAGTTGCCGGGTAACATTGCTCACT
>probe:Drosophila_2:1640652_at:25:119; Interrogation_Position=565; Antisense; AGCTCATTGCGCACACAACTTTATG
>probe:Drosophila_2:1640652_at:579:593; Interrogation_Position=588; Antisense; TGGGAATTTCCCGAGCACGTGGACT
>probe:Drosophila_2:1640652_at:624:529; Interrogation_Position=627; Antisense; GGGTTTCTTCTCCTTGCCGAAGAAG
>probe:Drosophila_2:1640652_at:240:443; Interrogation_Position=83; Antisense; GATGATTTGGACAGCCAGCGCCTGC

Paste this into a BLAST search page for me
GCCCACGAGTCACGATGCGAATTTATGCGAATTTAGCCACCTGCAAAACCGGGCACCTCTATTTGCTATACTATCTACTTCCCTGCAACAAGTTGGCCATAGTTGGCCATCATAGCCTCTATTTTACCGGGATCTGCAGCGGATACGATAGATACGATATTCTACAGGTCCTGGAAAGTTGCAGCAATTCGTGGTTTTCGGTGGTTTTCGCGAAGGAGCTATCCGAAGTTGCCGGGTAACATTGCTCACTAGCTCATTGCGCACACAACTTTATGTGGGAATTTCCCGAGCACGTGGACTGGGTTTCTTCTCCTTGCCGAAGAAGGATGATTTGGACAGCCAGCGCCTGC

Full Affymetrix probeset data:

Annotations for 1640652_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720