Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640654_at:

>probe:Drosophila_2:1640654_at:451:671; Interrogation_Position=118; Antisense; TACCAGTTCCTTTGGATACCGTTCT
>probe:Drosophila_2:1640654_at:85:29; Interrogation_Position=133; Antisense; ATACCGTTCTGAACATCCGCACAGA
>probe:Drosophila_2:1640654_at:182:125; Interrogation_Position=160; Antisense; ACCAATACATAGCAACCGTCCATCT
>probe:Drosophila_2:1640654_at:388:505; Interrogation_Position=177; Antisense; GTCCATCTCCAACTACTACAATGAC
>probe:Drosophila_2:1640654_at:248:95; Interrogation_Position=205; Antisense; AGATTCAACTTCAACTAGCTTTATG
>probe:Drosophila_2:1640654_at:318:683; Interrogation_Position=226; Antisense; TATGACAACAGATTCAACCCCAAGT
>probe:Drosophila_2:1640654_at:677:47; Interrogation_Position=259; Antisense; ATCCACTTCGGATACATCTACTGAA
>probe:Drosophila_2:1640654_at:465:157; Interrogation_Position=290; Antisense; ACACAGATTTCTGACTTCACCGAAA
>probe:Drosophila_2:1640654_at:654:483; Interrogation_Position=406; Antisense; GTATGGCATTGTAATTACCTTGGCT
>probe:Drosophila_2:1640654_at:2:129; Interrogation_Position=422; Antisense; ACCTTGGCTATTTTAGTTGCTCTAA
>probe:Drosophila_2:1640654_at:436:243; Interrogation_Position=445; Antisense; AATATACTGCATTCGACGCCATTAT
>probe:Drosophila_2:1640654_at:459:359; Interrogation_Position=495; Antisense; GCAAGCCCATTGAAAGTACCGCATA
>probe:Drosophila_2:1640654_at:60:191; Interrogation_Position=663; Antisense; AACATGACTCATTTATTTCCGACAA
>probe:Drosophila_2:1640654_at:106:703; Interrogation_Position=96; Antisense; TTTTCCTGGCACTGTTCACTTTTAC

Paste this into a BLAST search page for me
TACCAGTTCCTTTGGATACCGTTCTATACCGTTCTGAACATCCGCACAGAACCAATACATAGCAACCGTCCATCTGTCCATCTCCAACTACTACAATGACAGATTCAACTTCAACTAGCTTTATGTATGACAACAGATTCAACCCCAAGTATCCACTTCGGATACATCTACTGAAACACAGATTTCTGACTTCACCGAAAGTATGGCATTGTAATTACCTTGGCTACCTTGGCTATTTTAGTTGCTCTAAAATATACTGCATTCGACGCCATTATGCAAGCCCATTGAAAGTACCGCATAAACATGACTCATTTATTTCCGACAATTTTCCTGGCACTGTTCACTTTTAC

Full Affymetrix probeset data:

Annotations for 1640654_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime