FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640657_at:

>probe:Drosophila_2:1640657_at:727:661; Interrogation_Position=155; Antisense; TACAACAGGTTGGACTCTTTCGGGT
>probe:Drosophila_2:1640657_at:404:405; Interrogation_Position=167; Antisense; GACTCTTTCGGGTGAGCACATCCAA
>probe:Drosophila_2:1640657_at:664:543; Interrogation_Position=242; Antisense; GGATTTCTGTTGATACATGCCCACA
>probe:Drosophila_2:1640657_at:569:151; Interrogation_Position=264; Antisense; ACATGATGTTGCCACACTGCTTAAA
>probe:Drosophila_2:1640657_at:244:697; Interrogation_Position=292; Antisense; TTTTTACGTGATCTTCCGGAACCAT
>probe:Drosophila_2:1640657_at:57:563; Interrogation_Position=309; Antisense; GGAACCATTACTTTGCAACACACTC
>probe:Drosophila_2:1640657_at:495:139; Interrogation_Position=357; Antisense; ACGTATTCGGAATCGACGCTTGCAA
>probe:Drosophila_2:1640657_at:80:411; Interrogation_Position=371; Antisense; GACGCTTGCAACTAGAGGCTATATC
>probe:Drosophila_2:1640657_at:69:723; Interrogation_Position=400; Antisense; TTGATAAGACTACTTCCGATCCCAC
>probe:Drosophila_2:1640657_at:10:295; Interrogation_Position=416; Antisense; CGATCCCACACAGAGACACGTTGTA
>probe:Drosophila_2:1640657_at:545:257; Interrogation_Position=432; Antisense; CACGTTGTACGTCTTACTAGTATTT
>probe:Drosophila_2:1640657_at:445:521; Interrogation_Position=466; Antisense; GTGGCAGCACACAGCGATGATATAT
>probe:Drosophila_2:1640657_at:9:703; Interrogation_Position=569; Antisense; TTTTGCGAAGCACTCATTTGACATT
>probe:Drosophila_2:1640657_at:99:131; Interrogation_Position=690; Antisense; ACCTAATCTACCGTCTCGTTAATTG

Paste this into a BLAST search page for me
TACAACAGGTTGGACTCTTTCGGGTGACTCTTTCGGGTGAGCACATCCAAGGATTTCTGTTGATACATGCCCACAACATGATGTTGCCACACTGCTTAAATTTTTACGTGATCTTCCGGAACCATGGAACCATTACTTTGCAACACACTCACGTATTCGGAATCGACGCTTGCAAGACGCTTGCAACTAGAGGCTATATCTTGATAAGACTACTTCCGATCCCACCGATCCCACACAGAGACACGTTGTACACGTTGTACGTCTTACTAGTATTTGTGGCAGCACACAGCGATGATATATTTTTGCGAAGCACTCATTTGACATTACCTAATCTACCGTCTCGTTAATTG

Full Affymetrix probeset data:

Annotations for 1640657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720