FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640658_at:

>probe:Drosophila_2:1640658_at:493:449; Interrogation_Position=462; Antisense; GATCCGGGATGGTGATCTCTACACC
>probe:Drosophila_2:1640658_at:243:513; Interrogation_Position=496; Antisense; GTGATCCAAAACGACCCAGAGCTGA
>probe:Drosophila_2:1640658_at:525:101; Interrogation_Position=513; Antisense; AGAGCTGATCACACCCGGAGATTCG
>probe:Drosophila_2:1640658_at:325:567; Interrogation_Position=563; Antisense; GGCAGCCTCGCAACCTGGACGTGGA
>probe:Drosophila_2:1640658_at:165:577; Interrogation_Position=615; Antisense; GGCCACTGGTTCGAAAATCACACTC
>probe:Drosophila_2:1640658_at:485:157; Interrogation_Position=629; Antisense; AAATCACACTCACAAGTCCTGATCC
>probe:Drosophila_2:1640658_at:276:667; Interrogation_Position=674; Antisense; TACATAACTCGGTGGTCAGCAACAG
>probe:Drosophila_2:1640658_at:508:405; Interrogation_Position=700; Antisense; GACTCGGTCGCATACATACCAAAGT
>probe:Drosophila_2:1640658_at:730:101; Interrogation_Position=717; Antisense; ACCAAAGTTCAGTCGGCCAAATAGA
>probe:Drosophila_2:1640658_at:272:239; Interrogation_Position=736; Antisense; AATAGAACCATACACCTGGGCTCCG
>probe:Drosophila_2:1640658_at:446:41; Interrogation_Position=780; Antisense; ATCGTCCTCCCAGGCGCGAGATGAG
>probe:Drosophila_2:1640658_at:634:325; Interrogation_Position=795; Antisense; GCGAGATGAGCTCTAGGAACACCTA
>probe:Drosophila_2:1640658_at:50:111; Interrogation_Position=914; Antisense; AGAATGCGACGCAGGCGCCAACGGA
>probe:Drosophila_2:1640658_at:512:329; Interrogation_Position=959; Antisense; GCGGCAAATGCATTAACACCACTTC

Paste this into a BLAST search page for me
GATCCGGGATGGTGATCTCTACACCGTGATCCAAAACGACCCAGAGCTGAAGAGCTGATCACACCCGGAGATTCGGGCAGCCTCGCAACCTGGACGTGGAGGCCACTGGTTCGAAAATCACACTCAAATCACACTCACAAGTCCTGATCCTACATAACTCGGTGGTCAGCAACAGGACTCGGTCGCATACATACCAAAGTACCAAAGTTCAGTCGGCCAAATAGAAATAGAACCATACACCTGGGCTCCGATCGTCCTCCCAGGCGCGAGATGAGGCGAGATGAGCTCTAGGAACACCTAAGAATGCGACGCAGGCGCCAACGGAGCGGCAAATGCATTAACACCACTTC

Full Affymetrix probeset data:

Annotations for 1640658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720