FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640660_at:

>probe:Drosophila_2:1640660_at:259:637; Interrogation_Position=1110; Antisense; TCAACCCGACGGCTACCAGTACTAA
>probe:Drosophila_2:1640660_at:418:279; Interrogation_Position=1122; Antisense; CTACCAGTACTAAGTCTAGCGTGTA
>probe:Drosophila_2:1640660_at:604:497; Interrogation_Position=1135; Antisense; GTCTAGCGTGTAGTGTATACCAATT
>probe:Drosophila_2:1640660_at:5:27; Interrogation_Position=1151; Antisense; ATACCAATTTGGACGAGACGAGAAA
>probe:Drosophila_2:1640660_at:263:463; Interrogation_Position=1189; Antisense; GATTCATCAATGAAGCCTGCTCTGG
>probe:Drosophila_2:1640660_at:507:379; Interrogation_Position=1200; Antisense; GAAGCCTGCTCTGGGATATGTTAAG
>probe:Drosophila_2:1640660_at:560:95; Interrogation_Position=1223; Antisense; AGATTTCCATTCTTCTTTCTAATAT
>probe:Drosophila_2:1640660_at:278:615; Interrogation_Position=1247; Antisense; TGCATTTAACAACCGGGAAACCACT
>probe:Drosophila_2:1640660_at:469:203; Interrogation_Position=1265; Antisense; AACCACTGGGAGACATTTAGATCAT
>probe:Drosophila_2:1640660_at:578:601; Interrogation_Position=1293; Antisense; TGTATTTCCATTTAGTAGTCGCAAT
>probe:Drosophila_2:1640660_at:664:501; Interrogation_Position=1310; Antisense; GTCGCAATACAATCTTCGAATTCTT
>probe:Drosophila_2:1640660_at:717:247; Interrogation_Position=1395; Antisense; AATTGACTCTCGATTCTTGATTTTT
>probe:Drosophila_2:1640660_at:345:523; Interrogation_Position=1545; Antisense; GGGCTCCCTCTAATTTAATGTCCAA
>probe:Drosophila_2:1640660_at:394:61; Interrogation_Position=1562; Antisense; ATGTCCAATCCTTTGAAGTTATGTA

Paste this into a BLAST search page for me
TCAACCCGACGGCTACCAGTACTAACTACCAGTACTAAGTCTAGCGTGTAGTCTAGCGTGTAGTGTATACCAATTATACCAATTTGGACGAGACGAGAAAGATTCATCAATGAAGCCTGCTCTGGGAAGCCTGCTCTGGGATATGTTAAGAGATTTCCATTCTTCTTTCTAATATTGCATTTAACAACCGGGAAACCACTAACCACTGGGAGACATTTAGATCATTGTATTTCCATTTAGTAGTCGCAATGTCGCAATACAATCTTCGAATTCTTAATTGACTCTCGATTCTTGATTTTTGGGCTCCCTCTAATTTAATGTCCAAATGTCCAATCCTTTGAAGTTATGTA

Full Affymetrix probeset data:

Annotations for 1640660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720