Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640661_at:

>probe:Drosophila_2:1640661_at:16:77; Interrogation_Position=3838; Antisense; AGGATGTGCGCAATGCACTGCGTGC
>probe:Drosophila_2:1640661_at:280:427; Interrogation_Position=3871; Antisense; GAGATGTTGGACTAGCCACGCGGCA
>probe:Drosophila_2:1640661_at:112:675; Interrogation_Position=3883; Antisense; TAGCCACGCGGCACTACAAAATCGA
>probe:Drosophila_2:1640661_at:703:183; Interrogation_Position=3900; Antisense; AAAATCGACCAACTGGCGAGGCTTG
>probe:Drosophila_2:1640661_at:513:335; Interrogation_Position=3956; Antisense; GCTGCAGCAGACCAACTGGAGCTTA
>probe:Drosophila_2:1640661_at:368:677; Interrogation_Position=3979; Antisense; TAGAGGTGGCAGCTGAACTACTACT
>probe:Drosophila_2:1640661_at:685:383; Interrogation_Position=3993; Antisense; GAACTACTACTGAATGCCGGCTAAA
>probe:Drosophila_2:1640661_at:670:665; Interrogation_Position=4027; Antisense; TACAACCATGTATTACCGCCTCGAA
>probe:Drosophila_2:1640661_at:78:133; Interrogation_Position=4041; Antisense; ACCGCCTCGAATGTAATTGCTTTAG
>probe:Drosophila_2:1640661_at:470:245; Interrogation_Position=4055; Antisense; AATTGCTTTAGTTTTACGTGCTGAA
>probe:Drosophila_2:1640661_at:609:669; Interrogation_Position=4125; Antisense; TACTCCTAGGTGAATGCGCGAATGC
>probe:Drosophila_2:1640661_at:111:477; Interrogation_Position=4221; Antisense; GTTATTCGATGTCCGCATTTTCTGA
>probe:Drosophila_2:1640661_at:406:273; Interrogation_Position=4236; Antisense; CATTTTCTGAGATGCCCCGAATATT
>probe:Drosophila_2:1640661_at:449:369; Interrogation_Position=4288; Antisense; GAATGAAGACCTCGGTTCGCTTCGG

Paste this into a BLAST search page for me
AGGATGTGCGCAATGCACTGCGTGCGAGATGTTGGACTAGCCACGCGGCATAGCCACGCGGCACTACAAAATCGAAAAATCGACCAACTGGCGAGGCTTGGCTGCAGCAGACCAACTGGAGCTTATAGAGGTGGCAGCTGAACTACTACTGAACTACTACTGAATGCCGGCTAAATACAACCATGTATTACCGCCTCGAAACCGCCTCGAATGTAATTGCTTTAGAATTGCTTTAGTTTTACGTGCTGAATACTCCTAGGTGAATGCGCGAATGCGTTATTCGATGTCCGCATTTTCTGACATTTTCTGAGATGCCCCGAATATTGAATGAAGACCTCGGTTCGCTTCGG

Full Affymetrix probeset data:

Annotations for 1640661_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime