FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640664_at:

>probe:Drosophila_2:1640664_at:248:49; Interrogation_Position=1430; Antisense; ATGCCAAGTTTGTGGTGGGCGCTTC
>probe:Drosophila_2:1640664_at:345:595; Interrogation_Position=1445; Antisense; TGGGCGCTTCCAATGGTGGCTACTA
>probe:Drosophila_2:1640664_at:487:229; Interrogation_Position=1456; Antisense; AATGGTGGCTACTACGTGCCCGTGG
>probe:Drosophila_2:1640664_at:294:447; Interrogation_Position=1504; Antisense; GATGCCAAGGTCTACAACGTATTCT
>probe:Drosophila_2:1640664_at:15:199; Interrogation_Position=1519; Antisense; AACGTATTCTCCAAGGTCAGTGCCA
>probe:Drosophila_2:1640664_at:236:99; Interrogation_Position=1658; Antisense; AGATGGGTGCTCTCAAGTCTGACGA
>probe:Drosophila_2:1640664_at:428:217; Interrogation_Position=1672; Antisense; AAGTCTGACGATCTGGACCTTATAC
>probe:Drosophila_2:1640664_at:252:553; Interrogation_Position=1686; Antisense; GGACCTTATACTGGGTTCCAAGCTG
>probe:Drosophila_2:1640664_at:353:205; Interrogation_Position=1723; Antisense; AAGCGACAGCGCAATGCCAAGGCCA
>probe:Drosophila_2:1640664_at:189:311; Interrogation_Position=1738; Antisense; GCCAAGGCCAACATTCTGCTGGAGG
>probe:Drosophila_2:1640664_at:39:67; Interrogation_Position=1783; Antisense; ATGGACTCGGACAGCGACGGCAAGT
>probe:Drosophila_2:1640664_at:617:407; Interrogation_Position=1798; Antisense; GACGGCAAGTATCCGCACACAGTGC
>probe:Drosophila_2:1640664_at:447:91; Interrogation_Position=1906; Antisense; AGTTATCTGCCCAGGCCGGGATTGC
>probe:Drosophila_2:1640664_at:630:389; Interrogation_Position=1932; Antisense; GAAAAAGGCCACACAGAGCAGTCTG

Paste this into a BLAST search page for me
ATGCCAAGTTTGTGGTGGGCGCTTCTGGGCGCTTCCAATGGTGGCTACTAAATGGTGGCTACTACGTGCCCGTGGGATGCCAAGGTCTACAACGTATTCTAACGTATTCTCCAAGGTCAGTGCCAAGATGGGTGCTCTCAAGTCTGACGAAAGTCTGACGATCTGGACCTTATACGGACCTTATACTGGGTTCCAAGCTGAAGCGACAGCGCAATGCCAAGGCCAGCCAAGGCCAACATTCTGCTGGAGGATGGACTCGGACAGCGACGGCAAGTGACGGCAAGTATCCGCACACAGTGCAGTTATCTGCCCAGGCCGGGATTGCGAAAAAGGCCACACAGAGCAGTCTG

Full Affymetrix probeset data:

Annotations for 1640664_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720