FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640665_at:

>probe:Drosophila_2:1640665_at:191:441; Interrogation_Position=104; Antisense; TGATCGGTAGGCAGAACAAAACATA
>probe:Drosophila_2:1640665_at:58:191; Interrogation_Position=123; Antisense; AACATACATCGATTTGTCCAAGGAG
>probe:Drosophila_2:1640665_at:27:69; Interrogation_Position=13; Antisense; ATGGCCAGTCTAGCCGCTTTACAGT
>probe:Drosophila_2:1640665_at:698:143; Interrogation_Position=161; Antisense; ACTGCAGCGAAGTGGCCAGGCTGAA
>probe:Drosophila_2:1640665_at:327:673; Interrogation_Position=23; Antisense; TAGCCGCTTTACAGTTGTCCGCTGG
>probe:Drosophila_2:1640665_at:401:167; Interrogation_Position=242; Antisense; AAATGCAGGGCGTCTATCAGCGCAC
>probe:Drosophila_2:1640665_at:483:497; Interrogation_Position=253; Antisense; GTCTATCAGCGCACCAAAGAGTTAA
>probe:Drosophila_2:1640665_at:184:583; Interrogation_Position=296; Antisense; TGGCGGCCTGCAAGCAGCGTGACTA
>probe:Drosophila_2:1640665_at:369:121; Interrogation_Position=311; Antisense; AGCGTGACTACCAGCGGAAACTCGA
>probe:Drosophila_2:1640665_at:294:561; Interrogation_Position=326; Antisense; GGAAACTCGAGAGGCTACAGCACGA
>probe:Drosophila_2:1640665_at:682:339; Interrogation_Position=339; Antisense; GCTACAGCACGAGGAGTCGCTCATT
>probe:Drosophila_2:1640665_at:165:581; Interrogation_Position=45; Antisense; TGGCGTCCTGCAAATAGCGGAGCCT
>probe:Drosophila_2:1640665_at:68:121; Interrogation_Position=60; Antisense; AGCGGAGCCTCCACTAAACCATGTG
>probe:Drosophila_2:1640665_at:307:507; Interrogation_Position=82; Antisense; GTGCGCACCCAGCTTAGGGAATTGA

Paste this into a BLAST search page for me
TGATCGGTAGGCAGAACAAAACATAAACATACATCGATTTGTCCAAGGAGATGGCCAGTCTAGCCGCTTTACAGTACTGCAGCGAAGTGGCCAGGCTGAATAGCCGCTTTACAGTTGTCCGCTGGAAATGCAGGGCGTCTATCAGCGCACGTCTATCAGCGCACCAAAGAGTTAATGGCGGCCTGCAAGCAGCGTGACTAAGCGTGACTACCAGCGGAAACTCGAGGAAACTCGAGAGGCTACAGCACGAGCTACAGCACGAGGAGTCGCTCATTTGGCGTCCTGCAAATAGCGGAGCCTAGCGGAGCCTCCACTAAACCATGTGGTGCGCACCCAGCTTAGGGAATTGA

Full Affymetrix probeset data:

Annotations for 1640665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720