FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640666_at:

>probe:Drosophila_2:1640666_at:148:531; Interrogation_Position=425; Antisense; GGGATTCCGACTCTAGCAATATCAA
>probe:Drosophila_2:1640666_at:574:685; Interrogation_Position=444; Antisense; TATCAATCTTGTCAGCGCAGTCACT
>probe:Drosophila_2:1640666_at:294:503; Interrogation_Position=469; Antisense; GTCCATCCAGATTACTCACCTAGGA
>probe:Drosophila_2:1640666_at:485:1; Interrogation_Position=534; Antisense; GGTGGTGTTTTCAGACTTGGTTCAA
>probe:Drosophila_2:1640666_at:454:589; Interrogation_Position=551; Antisense; TGGTTCAACCAATTTGCTTGCCTTC
>probe:Drosophila_2:1640666_at:70:345; Interrogation_Position=566; Antisense; GCTTGCCTTCAGTATCCGAAATGGT
>probe:Drosophila_2:1640666_at:531:171; Interrogation_Position=615; Antisense; AAAGCTTATCGTTGCCGGACTGGAG
>probe:Drosophila_2:1640666_at:33:421; Interrogation_Position=637; Antisense; GAGGGACCGTCATTCGACCGAAGGC
>probe:Drosophila_2:1640666_at:380:549; Interrogation_Position=753; Antisense; GGAGGAACTGATCTGTGGCCACACC
>probe:Drosophila_2:1640666_at:186:437; Interrogation_Position=780; Antisense; GAGGAGTCCTCTTTCAGGATCAGCT
>probe:Drosophila_2:1640666_at:336:73; Interrogation_Position=795; Antisense; AGGATCAGCTTTGACCGAGGCTTCG
>probe:Drosophila_2:1640666_at:387:245; Interrogation_Position=849; Antisense; AATTGCGGTTGCTGGATTCTTCTCG
>probe:Drosophila_2:1640666_at:227:463; Interrogation_Position=863; Antisense; GATTCTTCTCGTCTGACCTAGATCA
>probe:Drosophila_2:1640666_at:491:707; Interrogation_Position=898; Antisense; TTAAACATTCGACCCCATCTAGATT

Paste this into a BLAST search page for me
GGGATTCCGACTCTAGCAATATCAATATCAATCTTGTCAGCGCAGTCACTGTCCATCCAGATTACTCACCTAGGAGGTGGTGTTTTCAGACTTGGTTCAATGGTTCAACCAATTTGCTTGCCTTCGCTTGCCTTCAGTATCCGAAATGGTAAAGCTTATCGTTGCCGGACTGGAGGAGGGACCGTCATTCGACCGAAGGCGGAGGAACTGATCTGTGGCCACACCGAGGAGTCCTCTTTCAGGATCAGCTAGGATCAGCTTTGACCGAGGCTTCGAATTGCGGTTGCTGGATTCTTCTCGGATTCTTCTCGTCTGACCTAGATCATTAAACATTCGACCCCATCTAGATT

Full Affymetrix probeset data:

Annotations for 1640666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720