FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640667_at:

>probe:Drosophila_2:1640667_at:314:55; Interrogation_Position=1379; Antisense; ATGAGGGCTACATCCCTGTGGGAAC
>probe:Drosophila_2:1640667_at:94:379; Interrogation_Position=1400; Antisense; GAACCAACGTGGTCGTACTTCTCTG
>probe:Drosophila_2:1640667_at:322:117; Interrogation_Position=1427; Antisense; AGCTCCTCCGGGATGAAGCGATCTT
>probe:Drosophila_2:1640667_at:117:109; Interrogation_Position=1491; Antisense; AGAAGAGGCACCCAGACTGAGTCCC
>probe:Drosophila_2:1640667_at:80:607; Interrogation_Position=1508; Antisense; TGAGTCCCTACAGCTACATACCTTT
>probe:Drosophila_2:1640667_at:129:277; Interrogation_Position=1526; Antisense; TACCTTTCTCCGCTGGGCCGAGGAA
>probe:Drosophila_2:1640667_at:185:171; Interrogation_Position=1600; Antisense; AAAGTGATACGCCACTACCAGCTGC
>probe:Drosophila_2:1640667_at:41:119; Interrogation_Position=1619; Antisense; AGCTGCTTCCAATGGGAGCCGATGT
>probe:Drosophila_2:1640667_at:147:417; Interrogation_Position=1634; Antisense; GAGCCGATGTGGAGCCATCCATTAA
>probe:Drosophila_2:1640667_at:299:13; Interrogation_Position=1654; Antisense; ATTAAAATAGTGCTGCGCTCCAAGA
>probe:Drosophila_2:1640667_at:399:335; Interrogation_Position=1695; Antisense; GCTGCGGCCGCGGTTGTATTGAAAA
>probe:Drosophila_2:1640667_at:28:461; Interrogation_Position=1746; Antisense; GATTTAGGATCAGCTGGCGCCAGAC
>probe:Drosophila_2:1640667_at:117:345; Interrogation_Position=1772; Antisense; GCTTGAATCTGCTTATCGCTATCGA
>probe:Drosophila_2:1640667_at:142:349; Interrogation_Position=1832; Antisense; GCAGGTGTAGTTTTTCACCGCCAAA

Paste this into a BLAST search page for me
ATGAGGGCTACATCCCTGTGGGAACGAACCAACGTGGTCGTACTTCTCTGAGCTCCTCCGGGATGAAGCGATCTTAGAAGAGGCACCCAGACTGAGTCCCTGAGTCCCTACAGCTACATACCTTTTACCTTTCTCCGCTGGGCCGAGGAAAAAGTGATACGCCACTACCAGCTGCAGCTGCTTCCAATGGGAGCCGATGTGAGCCGATGTGGAGCCATCCATTAAATTAAAATAGTGCTGCGCTCCAAGAGCTGCGGCCGCGGTTGTATTGAAAAGATTTAGGATCAGCTGGCGCCAGACGCTTGAATCTGCTTATCGCTATCGAGCAGGTGTAGTTTTTCACCGCCAAA

Full Affymetrix probeset data:

Annotations for 1640667_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720