Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640669_at:

>probe:Drosophila_2:1640669_at:385:615; Interrogation_Position=1109; Antisense; TGAATTGTAATTGCTCAGACTGATT
>probe:Drosophila_2:1640669_at:401:339; Interrogation_Position=1121; Antisense; GCTCAGACTGATTTGTTTATGGAAC
>probe:Drosophila_2:1640669_at:599:153; Interrogation_Position=1183; Antisense; ACAGGTGGCACGAGCATACTGTGCA
>probe:Drosophila_2:1640669_at:91:117; Interrogation_Position=1195; Antisense; AGCATACTGTGCAGCCTCCAAGAAG
>probe:Drosophila_2:1640669_at:418:375; Interrogation_Position=1216; Antisense; GAAGCCCCTGGAAGTTTCAAAGACT
>probe:Drosophila_2:1640669_at:383:403; Interrogation_Position=1237; Antisense; GACTTCCTTGATTTCTCTATATGTT
>probe:Drosophila_2:1640669_at:461:27; Interrogation_Position=1278; Antisense; ATACCAGATGTAGTATGCGTACTGT
>probe:Drosophila_2:1640669_at:519:491; Interrogation_Position=1352; Antisense; GTAAACGATTTGATTAGTCCCAGAG
>probe:Drosophila_2:1640669_at:252:391; Interrogation_Position=1376; Antisense; GAAACTCCAAGACAACCCAATGCGT
>probe:Drosophila_2:1640669_at:556:665; Interrogation_Position=1515; Antisense; TACACGCCTAGATACACTCCAATTA
>probe:Drosophila_2:1640669_at:709:649; Interrogation_Position=1542; Antisense; TAACTTTGGGTATCGTTCTACGAAT
>probe:Drosophila_2:1640669_at:215:473; Interrogation_Position=1556; Antisense; GTTCTACGAATTTTGCATACTGGAT
>probe:Drosophila_2:1640669_at:716:13; Interrogation_Position=1585; Antisense; ATTAAGGTGTATTTGATCTCATTCA
>probe:Drosophila_2:1640669_at:207:491; Interrogation_Position=1641; Antisense; GTAATTTCAATTATTCCCCTAAATG

Paste this into a BLAST search page for me
TGAATTGTAATTGCTCAGACTGATTGCTCAGACTGATTTGTTTATGGAACACAGGTGGCACGAGCATACTGTGCAAGCATACTGTGCAGCCTCCAAGAAGGAAGCCCCTGGAAGTTTCAAAGACTGACTTCCTTGATTTCTCTATATGTTATACCAGATGTAGTATGCGTACTGTGTAAACGATTTGATTAGTCCCAGAGGAAACTCCAAGACAACCCAATGCGTTACACGCCTAGATACACTCCAATTATAACTTTGGGTATCGTTCTACGAATGTTCTACGAATTTTGCATACTGGATATTAAGGTGTATTTGATCTCATTCAGTAATTTCAATTATTCCCCTAAATG

Full Affymetrix probeset data:

Annotations for 1640669_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime