Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640670_at:

>probe:Drosophila_2:1640670_at:142:281; Interrogation_Position=2981; Antisense; CTGCCCGTAATGTCCTTGTAAGCGA
>probe:Drosophila_2:1640670_at:14:305; Interrogation_Position=3026; Antisense; CCGATTTTGGTCTGGCGAGGGATAT
>probe:Drosophila_2:1640670_at:301:273; Interrogation_Position=3096; Antisense; CATTAAGTGGATGGCGCCCGAGTCG
>probe:Drosophila_2:1640670_at:200:489; Interrogation_Position=3135; Antisense; GTACGACTCACAGAGCGACGTCTGG
>probe:Drosophila_2:1640670_at:263:409; Interrogation_Position=3151; Antisense; GACGTCTGGAGCTATGGTGTTCTGC
>probe:Drosophila_2:1640670_at:714:255; Interrogation_Position=3214; Antisense; CACATACTGTCTGCCGAGGAGCTCT
>probe:Drosophila_2:1640670_at:495:437; Interrogation_Position=3229; Antisense; GAGGAGCTCTACAGCTACCTGATTA
>probe:Drosophila_2:1640670_at:526:617; Interrogation_Position=3283; Antisense; TGCTCCCTGAACATCTACGTGGTAA
>probe:Drosophila_2:1640670_at:437:583; Interrogation_Position=3319; Antisense; TGGCACTTTGAGTCCTGTGCACGAC
>probe:Drosophila_2:1640670_at:511:429; Interrogation_Position=3366; Antisense; GAGTTTCGATGGGATCCTGCAGCAG
>probe:Drosophila_2:1640670_at:47:171; Interrogation_Position=3405; Antisense; AAACGATGCCTATCTGGACCTTTCG
>probe:Drosophila_2:1640670_at:340:555; Interrogation_Position=3420; Antisense; GGACCTTTCGATGCCGATGCTGGAG
>probe:Drosophila_2:1640670_at:276:437; Interrogation_Position=3466; Antisense; GAGGATGATGGCTCCGACACCGAAA
>probe:Drosophila_2:1640670_at:683:175; Interrogation_Position=3500; Antisense; AAACGTCCCCGCTTAGATATCAGTA

Paste this into a BLAST search page for me
CTGCCCGTAATGTCCTTGTAAGCGACCGATTTTGGTCTGGCGAGGGATATCATTAAGTGGATGGCGCCCGAGTCGGTACGACTCACAGAGCGACGTCTGGGACGTCTGGAGCTATGGTGTTCTGCCACATACTGTCTGCCGAGGAGCTCTGAGGAGCTCTACAGCTACCTGATTATGCTCCCTGAACATCTACGTGGTAATGGCACTTTGAGTCCTGTGCACGACGAGTTTCGATGGGATCCTGCAGCAGAAACGATGCCTATCTGGACCTTTCGGGACCTTTCGATGCCGATGCTGGAGGAGGATGATGGCTCCGACACCGAAAAAACGTCCCCGCTTAGATATCAGTA

Full Affymetrix probeset data:

Annotations for 1640670_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime