FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640672_at:

>probe:Drosophila_2:1640672_at:307:321; Interrogation_Position=178; Antisense; GCCCGTGCGCTTCTGCAAAATGATG
>probe:Drosophila_2:1640672_at:377:55; Interrogation_Position=200; Antisense; ATGAACGATCCTTTGGAGCACGCCA
>probe:Drosophila_2:1640672_at:261:587; Interrogation_Position=213; Antisense; TGGAGCACGCCACTGGTATCGAGAA
>probe:Drosophila_2:1640672_at:594:43; Interrogation_Position=230; Antisense; ATCGAGAAGCGCGAGCTGCTGCTTA
>probe:Drosophila_2:1640672_at:357:247; Interrogation_Position=265; Antisense; CAATGATAACCCCTTCGACATGAAG
>probe:Drosophila_2:1640672_at:655:637; Interrogation_Position=345; Antisense; TCGATGCTCGCATTGTGGGCTGCAT
>probe:Drosophila_2:1640672_at:210:595; Interrogation_Position=360; Antisense; TGGGCTGCATCTGCGAAGAGGATCA
>probe:Drosophila_2:1640672_at:309:77; Interrogation_Position=378; Antisense; AGGATCAGACCTACGTGCAATGGAT
>probe:Drosophila_2:1640672_at:183:265; Interrogation_Position=422; Antisense; CAGAAACGTTGTGAGTGCGGCCATT
>probe:Drosophila_2:1640672_at:174:87; Interrogation_Position=435; Antisense; AGTGCGGCCATTGGTTCAAGCTGGT
>probe:Drosophila_2:1640672_at:464:651; Interrogation_Position=544; Antisense; TCAACCCACTTAGCTGTCCAAATAA
>probe:Drosophila_2:1640672_at:309:491; Interrogation_Position=621; Antisense; GTGAAAGGGCGGCACAGCTTCCATT
>probe:Drosophila_2:1640672_at:624:155; Interrogation_Position=634; Antisense; ACAGCTTCCATTTTCAGATCTGCAA
>probe:Drosophila_2:1640672_at:230:177; Interrogation_Position=657; Antisense; AAACGTGTTTTCGAACGCAGCCGAG

Paste this into a BLAST search page for me
GCCCGTGCGCTTCTGCAAAATGATGATGAACGATCCTTTGGAGCACGCCATGGAGCACGCCACTGGTATCGAGAAATCGAGAAGCGCGAGCTGCTGCTTACAATGATAACCCCTTCGACATGAAGTCGATGCTCGCATTGTGGGCTGCATTGGGCTGCATCTGCGAAGAGGATCAAGGATCAGACCTACGTGCAATGGATCAGAAACGTTGTGAGTGCGGCCATTAGTGCGGCCATTGGTTCAAGCTGGTTCAACCCACTTAGCTGTCCAAATAAGTGAAAGGGCGGCACAGCTTCCATTACAGCTTCCATTTTCAGATCTGCAAAAACGTGTTTTCGAACGCAGCCGAG

Full Affymetrix probeset data:

Annotations for 1640672_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720