FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640673_at:

>probe:Drosophila_2:1640673_at:233:663; Interrogation_Position=1041; Antisense; TAAATGGCCTTTTGTTAGTCCCTCT
>probe:Drosophila_2:1640673_at:541:679; Interrogation_Position=1056; Antisense; TAGTCCCTCTAAGTGTGCGAATGAA
>probe:Drosophila_2:1640673_at:253:323; Interrogation_Position=1072; Antisense; GCGAATGAATTCTCGGCTGTGCAGT
>probe:Drosophila_2:1640673_at:336:597; Interrogation_Position=1089; Antisense; TGTGCAGTCGTTTCTCTCGATGTAA
>probe:Drosophila_2:1640673_at:63:513; Interrogation_Position=586; Antisense; GTGTCAATCGTGCAACAAGCTGGGT
>probe:Drosophila_2:1640673_at:50:161; Interrogation_Position=600; Antisense; ACAAGCTGGGTCAATACTCCTGCCT
>probe:Drosophila_2:1640673_at:588:323; Interrogation_Position=625; Antisense; GCGCTGCAAGACCTGTTACTGCGAG
>probe:Drosophila_2:1640673_at:460:601; Interrogation_Position=638; Antisense; TGTTACTGCGAGGATCACGTGCGTC
>probe:Drosophila_2:1640673_at:571:139; Interrogation_Position=654; Antisense; ACGTGCGTCGCAAGGGCTTCAAGTA
>probe:Drosophila_2:1640673_at:690:211; Interrogation_Position=683; Antisense; AAGAACAAGCCAATTCCATGCCCCA
>probe:Drosophila_2:1640673_at:116:309; Interrogation_Position=698; Antisense; CCATGCCCCAAGTGCAACTACGATA
>probe:Drosophila_2:1640673_at:287:185; Interrogation_Position=713; Antisense; AACTACGATACCTCGGTGACCAAGG
>probe:Drosophila_2:1640673_at:452:225; Interrogation_Position=734; Antisense; AAGGACCTCAGCATGTCCACGCGGT
>probe:Drosophila_2:1640673_at:161:261; Interrogation_Position=751; Antisense; CACGCGGTCGCACAAATTCGGGCGA

Paste this into a BLAST search page for me
TAAATGGCCTTTTGTTAGTCCCTCTTAGTCCCTCTAAGTGTGCGAATGAAGCGAATGAATTCTCGGCTGTGCAGTTGTGCAGTCGTTTCTCTCGATGTAAGTGTCAATCGTGCAACAAGCTGGGTACAAGCTGGGTCAATACTCCTGCCTGCGCTGCAAGACCTGTTACTGCGAGTGTTACTGCGAGGATCACGTGCGTCACGTGCGTCGCAAGGGCTTCAAGTAAAGAACAAGCCAATTCCATGCCCCACCATGCCCCAAGTGCAACTACGATAAACTACGATACCTCGGTGACCAAGGAAGGACCTCAGCATGTCCACGCGGTCACGCGGTCGCACAAATTCGGGCGA

Full Affymetrix probeset data:

Annotations for 1640673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720