FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640674_at:

>probe:Drosophila_2:1640674_at:100:397; Interrogation_Position=2240; Antisense; GAAATTCGACAGCTGCCACGGGTTT
>probe:Drosophila_2:1640674_at:712:593; Interrogation_Position=2273; Antisense; TGGGCGATGCCACCGATATACGCTA
>probe:Drosophila_2:1640674_at:626:19; Interrogation_Position=2288; Antisense; ATATACGCTACCTGCAGTTGACCAA
>probe:Drosophila_2:1640674_at:377:603; Interrogation_Position=2367; Antisense; TGTTCAGCAGGGATCGCATCTCAAG
>probe:Drosophila_2:1640674_at:432:655; Interrogation_Position=2400; Antisense; TAATAATGCAATCCTGACCCTGCTC
>probe:Drosophila_2:1640674_at:288:295; Interrogation_Position=2469; Antisense; CGACGAAGCTCTGGCCAAGTGCGAT
>probe:Drosophila_2:1640674_at:355:441; Interrogation_Position=2512; Antisense; GATGGCATCTCGATCCAGAACATTG
>probe:Drosophila_2:1640674_at:531:3; Interrogation_Position=2533; Antisense; ATTGGCGGCGTCTTCATTGTCATAT
>probe:Drosophila_2:1640674_at:146:5; Interrogation_Position=2566; Antisense; ATTGGAATGGCCTGCATCACGCTGG
>probe:Drosophila_2:1640674_at:676:33; Interrogation_Position=2581; Antisense; ATCACGCTGGTCTTTGAGTACTGGT
>probe:Drosophila_2:1640674_at:632:543; Interrogation_Position=2630; Antisense; GGATCATCGATGTGGCCGAAGCCAA
>probe:Drosophila_2:1640674_at:1:53; Interrogation_Position=2654; Antisense; ATGCGGAGCGATCCAATGCTGCTGA
>probe:Drosophila_2:1640674_at:264:253; Interrogation_Position=2688; Antisense; CAAGCTGGTCGATGGTGTGATCCTT
>probe:Drosophila_2:1640674_at:257:687; Interrogation_Position=2764; Antisense; TTTAATCAGTATCCGGCCACGTTTA

Paste this into a BLAST search page for me
GAAATTCGACAGCTGCCACGGGTTTTGGGCGATGCCACCGATATACGCTAATATACGCTACCTGCAGTTGACCAATGTTCAGCAGGGATCGCATCTCAAGTAATAATGCAATCCTGACCCTGCTCCGACGAAGCTCTGGCCAAGTGCGATGATGGCATCTCGATCCAGAACATTGATTGGCGGCGTCTTCATTGTCATATATTGGAATGGCCTGCATCACGCTGGATCACGCTGGTCTTTGAGTACTGGTGGATCATCGATGTGGCCGAAGCCAAATGCGGAGCGATCCAATGCTGCTGACAAGCTGGTCGATGGTGTGATCCTTTTTAATCAGTATCCGGCCACGTTTA

Full Affymetrix probeset data:

Annotations for 1640674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720