FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640675_at:

>probe:Drosophila_2:1640675_at:374:381; Interrogation_Position=101; Antisense; GAACGATTTGAAGGTGGTCTGCAAC
>probe:Drosophila_2:1640675_at:43:711; Interrogation_Position=108; Antisense; TTGAAGGTGGTCTGCAACAACAACA
>probe:Drosophila_2:1640675_at:90:155; Interrogation_Position=175; Antisense; ACAGCAGGAGGAGGGTGTCATCTTC
>probe:Drosophila_2:1640675_at:133:435; Interrogation_Position=185; Antisense; GAGGGTGTCATCTTCAGAGGTCCTT
>probe:Drosophila_2:1640675_at:300:513; Interrogation_Position=189; Antisense; GTGTCATCTTCAGAGGTCCTTTCGG
>probe:Drosophila_2:1640675_at:178:275; Interrogation_Position=196; Antisense; CTTCAGAGGTCCTTTCGGCGGCGGA
>probe:Drosophila_2:1640675_at:21:549; Interrogation_Position=218; Antisense; GGAGTGGAGTTCTTCCAGGAGCAAC
>probe:Drosophila_2:1640675_at:723:587; Interrogation_Position=222; Antisense; TGGAGTTCTTCCAGGAGCAACAGCA
>probe:Drosophila_2:1640675_at:394:455; Interrogation_Position=25; Antisense; GATAATCGTTTTTGTTGCGCTCCTC
>probe:Drosophila_2:1640675_at:287:353; Interrogation_Position=280; Antisense; GCAGCAGGAGAACCTATTTAACTTC
>probe:Drosophila_2:1640675_at:440:399; Interrogation_Position=287; Antisense; GAGAACCTATTTAACTTCTTCGGCT
>probe:Drosophila_2:1640675_at:494:691; Interrogation_Position=35; Antisense; TTTGTTGCGCTCCTCGCCTTTGCAT
>probe:Drosophila_2:1640675_at:695:693; Interrogation_Position=53; Antisense; TTTGCATCGGCCCAGTTCGGTCCGT
>probe:Drosophila_2:1640675_at:96:639; Interrogation_Position=69; Antisense; TCGGTCCGTTTGGTCAAATTATTAG

Paste this into a BLAST search page for me
GAACGATTTGAAGGTGGTCTGCAACTTGAAGGTGGTCTGCAACAACAACAACAGCAGGAGGAGGGTGTCATCTTCGAGGGTGTCATCTTCAGAGGTCCTTGTGTCATCTTCAGAGGTCCTTTCGGCTTCAGAGGTCCTTTCGGCGGCGGAGGAGTGGAGTTCTTCCAGGAGCAACTGGAGTTCTTCCAGGAGCAACAGCAGATAATCGTTTTTGTTGCGCTCCTCGCAGCAGGAGAACCTATTTAACTTCGAGAACCTATTTAACTTCTTCGGCTTTTGTTGCGCTCCTCGCCTTTGCATTTTGCATCGGCCCAGTTCGGTCCGTTCGGTCCGTTTGGTCAAATTATTAG

Full Affymetrix probeset data:

Annotations for 1640675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720