Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640679_at:

>probe:Drosophila_2:1640679_at:170:5; Interrogation_Position=6753; Antisense; ATTGTCACCGCAGGACATTACGACG
>probe:Drosophila_2:1640679_at:242:213; Interrogation_Position=6820; Antisense; AAGACGATCGTGATCACGTGCTCCT
>probe:Drosophila_2:1640679_at:349:207; Interrogation_Position=6877; Antisense; AAGCTGACGCCTTCGGGCTTCGAGT
>probe:Drosophila_2:1640679_at:432:381; Interrogation_Position=6961; Antisense; GAACGCGTTCAGATGCTGTTGTCGA
>probe:Drosophila_2:1640679_at:517:185; Interrogation_Position=6985; Antisense; AACAAGTTCCTTGGGTTCTTCATGG
>probe:Drosophila_2:1640679_at:278:507; Interrogation_Position=7009; Antisense; GTGCCGGCGCAAAGCAGCTGGAACT
>probe:Drosophila_2:1640679_at:304:385; Interrogation_Position=7029; Antisense; GAACTACAACTTCATGGGCGTGCGC
>probe:Drosophila_2:1640679_at:235:313; Interrogation_Position=7052; Antisense; GCCACGATCCCAACATGAAGTACGA
>probe:Drosophila_2:1640679_at:205:579; Interrogation_Position=7086; Antisense; GGCCAACCCGAAGGAGTTCTATCAC
>probe:Drosophila_2:1640679_at:118:473; Interrogation_Position=7101; Antisense; GTTCTATCACGAGTTGCATCGCACC
>probe:Drosophila_2:1640679_at:367:515; Interrogation_Position=7192; Antisense; GTGTACGCGTAAGCGGTGCGCATAT
>probe:Drosophila_2:1640679_at:714:621; Interrogation_Position=7208; Antisense; TGCGCATATGGAGTCTTAGGGTTCT
>probe:Drosophila_2:1640679_at:618:81; Interrogation_Position=7225; Antisense; AGGGTTCTCGTTTTAGTGCATACAA
>probe:Drosophila_2:1640679_at:265:315; Interrogation_Position=7262; Antisense; GCCTGTTTTCAATATGCTAGCATGT

Paste this into a BLAST search page for me
ATTGTCACCGCAGGACATTACGACGAAGACGATCGTGATCACGTGCTCCTAAGCTGACGCCTTCGGGCTTCGAGTGAACGCGTTCAGATGCTGTTGTCGAAACAAGTTCCTTGGGTTCTTCATGGGTGCCGGCGCAAAGCAGCTGGAACTGAACTACAACTTCATGGGCGTGCGCGCCACGATCCCAACATGAAGTACGAGGCCAACCCGAAGGAGTTCTATCACGTTCTATCACGAGTTGCATCGCACCGTGTACGCGTAAGCGGTGCGCATATTGCGCATATGGAGTCTTAGGGTTCTAGGGTTCTCGTTTTAGTGCATACAAGCCTGTTTTCAATATGCTAGCATGT

Full Affymetrix probeset data:

Annotations for 1640679_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime