FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640681_at:

>probe:Drosophila_2:1640681_at:636:57; Interrogation_Position=1240; Antisense; ATGTTTGTGCCCTATCTGACTAATC
>probe:Drosophila_2:1640681_at:77:279; Interrogation_Position=1276; Antisense; CTCATCGACGGCAATGGGCTGACTG
>probe:Drosophila_2:1640681_at:63:395; Interrogation_Position=1310; Antisense; GAAATCGCACGTTTTCCGAAGCTTT
>probe:Drosophila_2:1640681_at:436:91; Interrogation_Position=1356; Antisense; AGTATCGAGGAACCGCTTCAACTGC
>probe:Drosophila_2:1640681_at:63:303; Interrogation_Position=1417; Antisense; CCCGAGTCCGTAGTGCTCAATATTG
>probe:Drosophila_2:1640681_at:218:7; Interrogation_Position=1438; Antisense; ATTGAACCGGACACCAATCTGGATG
>probe:Drosophila_2:1640681_at:339:587; Interrogation_Position=1457; Antisense; TGGATGAGACCCCACACATTCGTGA
>probe:Drosophila_2:1640681_at:655:149; Interrogation_Position=1472; Antisense; ACATTCGTGACGTATCCTGCATCAG
>probe:Drosophila_2:1640681_at:152:345; Interrogation_Position=1490; Antisense; GCATCAGTCAATCCCAGGAGGTCGT
>probe:Drosophila_2:1640681_at:6:467; Interrogation_Position=1578; Antisense; GTTGGATATTGTAGGCTCGCATTCG
>probe:Drosophila_2:1640681_at:94:209; Interrogation_Position=1603; Antisense; AAGAATCTGGAACTTCACCTGGCCT
>probe:Drosophila_2:1640681_at:320:37; Interrogation_Position=1636; Antisense; ATCTTTGCGTACGTTATGGGCGGCC
>probe:Drosophila_2:1640681_at:279:519; Interrogation_Position=1675; Antisense; GTGGTGTCACTGATAACCCTTCGAT
>probe:Drosophila_2:1640681_at:403:227; Interrogation_Position=1764; Antisense; AATGGAAGCTAATCTCACCCTGGGC

Paste this into a BLAST search page for me
ATGTTTGTGCCCTATCTGACTAATCCTCATCGACGGCAATGGGCTGACTGGAAATCGCACGTTTTCCGAAGCTTTAGTATCGAGGAACCGCTTCAACTGCCCCGAGTCCGTAGTGCTCAATATTGATTGAACCGGACACCAATCTGGATGTGGATGAGACCCCACACATTCGTGAACATTCGTGACGTATCCTGCATCAGGCATCAGTCAATCCCAGGAGGTCGTGTTGGATATTGTAGGCTCGCATTCGAAGAATCTGGAACTTCACCTGGCCTATCTTTGCGTACGTTATGGGCGGCCGTGGTGTCACTGATAACCCTTCGATAATGGAAGCTAATCTCACCCTGGGC

Full Affymetrix probeset data:

Annotations for 1640681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720