FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640682_at:

>probe:Drosophila_2:1640682_at:192:289; Interrogation_Position=101; Antisense; CGGTGACCACTGTACGGCAGGACGT
>probe:Drosophila_2:1640682_at:350:557; Interrogation_Position=120; Antisense; GGACGTGGCCATTCCATTGTGGCAT
>probe:Drosophila_2:1640682_at:628:561; Interrogation_Position=198; Antisense; GGAACTTCCGCGTACACTGTACAAT
>probe:Drosophila_2:1640682_at:633:585; Interrogation_Position=247; Antisense; TGGAAATACATTCGCCACGTATCCG
>probe:Drosophila_2:1640682_at:624:709; Interrogation_Position=292; Antisense; TTAATACTCTCGAAGGGTGCCAGCA
>probe:Drosophila_2:1640682_at:491:535; Interrogation_Position=307; Antisense; GGTGCCAGCAATATGAGTCTCGCCT
>probe:Drosophila_2:1640682_at:378:303; Interrogation_Position=329; Antisense; CCTGTCCACTGAAAACGGGCGTATA
>probe:Drosophila_2:1640682_at:398:177; Interrogation_Position=383; Antisense; AAACGGCGCTCCTGAAGTTCATGTA
>probe:Drosophila_2:1640682_at:182:473; Interrogation_Position=399; Antisense; GTTCATGTACCATCCAAACACACTG
>probe:Drosophila_2:1640682_at:275:179; Interrogation_Position=414; Antisense; AAACACACTGTACACCCTGGAGGGC
>probe:Drosophila_2:1640682_at:246:589; Interrogation_Position=431; Antisense; TGGAGGGCACTGTTTACTCTCTGAA
>probe:Drosophila_2:1640682_at:305:369; Interrogation_Position=501; Antisense; GAATGCCACCATCTACAAATCTTGT
>probe:Drosophila_2:1640682_at:115:63; Interrogation_Position=56; Antisense; ATGGGCTCAAACTCAACATGTTCGA
>probe:Drosophila_2:1640682_at:201:107; Interrogation_Position=83; Antisense; AGAACAACTCGATGTCCTCGGTGAC

Paste this into a BLAST search page for me
CGGTGACCACTGTACGGCAGGACGTGGACGTGGCCATTCCATTGTGGCATGGAACTTCCGCGTACACTGTACAATTGGAAATACATTCGCCACGTATCCGTTAATACTCTCGAAGGGTGCCAGCAGGTGCCAGCAATATGAGTCTCGCCTCCTGTCCACTGAAAACGGGCGTATAAAACGGCGCTCCTGAAGTTCATGTAGTTCATGTACCATCCAAACACACTGAAACACACTGTACACCCTGGAGGGCTGGAGGGCACTGTTTACTCTCTGAAGAATGCCACCATCTACAAATCTTGTATGGGCTCAAACTCAACATGTTCGAAGAACAACTCGATGTCCTCGGTGAC

Full Affymetrix probeset data:

Annotations for 1640682_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720