FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640683_at:

>probe:Drosophila_2:1640683_at:263:299; Interrogation_Position=139; Antisense; CGCTGCCGTGGTTGAGAATGCCGAT
>probe:Drosophila_2:1640683_at:503:379; Interrogation_Position=197; Antisense; GAAGCCACTGATGCGGAGGAATCTT
>probe:Drosophila_2:1640683_at:705:693; Interrogation_Position=21; Antisense; TTTCGCGATAACTTCTTAGACTCAA
>probe:Drosophila_2:1640683_at:90:407; Interrogation_Position=238; Antisense; GACTGAAGAGTCTGGTGATGCCGCT
>probe:Drosophila_2:1640683_at:555:407; Interrogation_Position=263; Antisense; GACGAATCCAGCGATGATGCCGATG
>probe:Drosophila_2:1640683_at:261:77; Interrogation_Position=288; Antisense; AGGATGAGACAACCACTGCAGCTTC
>probe:Drosophila_2:1640683_at:19:717; Interrogation_Position=335; Antisense; TTCTGGCCCAGGTTCGGAGGTCATG
>probe:Drosophila_2:1640683_at:114:269; Interrogation_Position=356; Antisense; CATGGTCCAGTTGTGATCAGGCGTC
>probe:Drosophila_2:1640683_at:273:601; Interrogation_Position=369; Antisense; TGATCAGGCGTCACCCTAGTCTTGT
>probe:Drosophila_2:1640683_at:581:497; Interrogation_Position=387; Antisense; GTCTTGTCTAGGTCAAAGCCCTATA
>probe:Drosophila_2:1640683_at:373:125; Interrogation_Position=403; Antisense; AGCCCTATAGTCTTGATTGCTTAAC
>probe:Drosophila_2:1640683_at:162:465; Interrogation_Position=417; Antisense; GATTGCTTAACTATTCCTTTCTATT
>probe:Drosophila_2:1640683_at:266:651; Interrogation_Position=48; Antisense; TCAAAATGCGTTCCCTGATTCTTGT
>probe:Drosophila_2:1640683_at:82:605; Interrogation_Position=63; Antisense; TGATTCTTGTCGCTCTTTTGGCCTT

Paste this into a BLAST search page for me
CGCTGCCGTGGTTGAGAATGCCGATGAAGCCACTGATGCGGAGGAATCTTTTTCGCGATAACTTCTTAGACTCAAGACTGAAGAGTCTGGTGATGCCGCTGACGAATCCAGCGATGATGCCGATGAGGATGAGACAACCACTGCAGCTTCTTCTGGCCCAGGTTCGGAGGTCATGCATGGTCCAGTTGTGATCAGGCGTCTGATCAGGCGTCACCCTAGTCTTGTGTCTTGTCTAGGTCAAAGCCCTATAAGCCCTATAGTCTTGATTGCTTAACGATTGCTTAACTATTCCTTTCTATTTCAAAATGCGTTCCCTGATTCTTGTTGATTCTTGTCGCTCTTTTGGCCTT

Full Affymetrix probeset data:

Annotations for 1640683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720