FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640684_at:

>probe:Drosophila_2:1640684_at:156:439; Interrogation_Position=442; Antisense; GAGGCACGTGCCAAAGCCGAATACG
>probe:Drosophila_2:1640684_at:117:377; Interrogation_Position=496; Antisense; GAAGCATTTCGCAGCCAGAAGTACG
>probe:Drosophila_2:1640684_at:255:371; Interrogation_Position=522; Antisense; GAAGGCAATCCTACATTATGACAAG
>probe:Drosophila_2:1640684_at:289:657; Interrogation_Position=561; Antisense; TAAGGACAGCGCTATTACATATTGC
>probe:Drosophila_2:1640684_at:180:709; Interrogation_Position=575; Antisense; TTACATATTGCAATCGCGCCTTGTG
>probe:Drosophila_2:1640684_at:536:321; Interrogation_Position=590; Antisense; GCGCCTTGTGCTACATCAAGCTACA
>probe:Drosophila_2:1640684_at:684:665; Interrogation_Position=611; Antisense; TACAGAACTATAAGCGCGCCCTCAA
>probe:Drosophila_2:1640684_at:397:225; Interrogation_Position=634; Antisense; AAGGACTGCCAGTACGTGTTGGAGA
>probe:Drosophila_2:1640684_at:386:75; Interrogation_Position=665; Antisense; AGGAGAGTAATCTCCGCGCCTGGCT
>probe:Drosophila_2:1640684_at:367:267; Interrogation_Position=694; Antisense; CAGGCCCACGCCTACAAGGGTTTGA
>probe:Drosophila_2:1640684_at:393:139; Interrogation_Position=756; Antisense; ACGTGAACACAATCCCAAGCAACTG
>probe:Drosophila_2:1640684_at:717:111; Interrogation_Position=773; Antisense; AGCAACTGGCGTACATTGACAAGTA
>probe:Drosophila_2:1640684_at:114:143; Interrogation_Position=807; Antisense; ACTGGAAGCCGATCTTAAAGCACTA
>probe:Drosophila_2:1640684_at:556:511; Interrogation_Position=921; Antisense; GTGAACACTGCCCAAATCTGTGAAG

Paste this into a BLAST search page for me
GAGGCACGTGCCAAAGCCGAATACGGAAGCATTTCGCAGCCAGAAGTACGGAAGGCAATCCTACATTATGACAAGTAAGGACAGCGCTATTACATATTGCTTACATATTGCAATCGCGCCTTGTGGCGCCTTGTGCTACATCAAGCTACATACAGAACTATAAGCGCGCCCTCAAAAGGACTGCCAGTACGTGTTGGAGAAGGAGAGTAATCTCCGCGCCTGGCTCAGGCCCACGCCTACAAGGGTTTGAACGTGAACACAATCCCAAGCAACTGAGCAACTGGCGTACATTGACAAGTAACTGGAAGCCGATCTTAAAGCACTAGTGAACACTGCCCAAATCTGTGAAG

Full Affymetrix probeset data:

Annotations for 1640684_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720