FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640687_at:

>probe:Drosophila_2:1640687_at:581:547; Interrogation_Position=105; Antisense; GGATGTGGAAGCCATGACCGTCCTA
>probe:Drosophila_2:1640687_at:715:275; Interrogation_Position=127; Antisense; CTAGATTGCCATCGGCTCAAGCGGG
>probe:Drosophila_2:1640687_at:544:75; Interrogation_Position=227; Antisense; AGGAGGGTCTCGATCCCGGAAGATT
>probe:Drosophila_2:1640687_at:89:217; Interrogation_Position=246; Antisense; AAGATTGGTGGGTCTATTGCTGGCC
>probe:Drosophila_2:1640687_at:18:275; Interrogation_Position=286; Antisense; CTTCTTTTCGTTCTCTTGTGTCGAA
>probe:Drosophila_2:1640687_at:609:167; Interrogation_Position=31; Antisense; AAATGTCGGGATCTCTTCAAAACTA
>probe:Drosophila_2:1640687_at:78:379; Interrogation_Position=367; Antisense; GAAGCTCCATCCGTTTTACCTCAAA
>probe:Drosophila_2:1640687_at:289:415; Interrogation_Position=407; Antisense; GAGCCGCCAACTGCAAGAGCTGGAT
>probe:Drosophila_2:1640687_at:495:51; Interrogation_Position=430; Antisense; ATGCGCAGGAGCTGTAGGCCATTCT
>probe:Drosophila_2:1640687_at:348:367; Interrogation_Position=466; Antisense; GAATCCCAGCTAAGACAGTACCAAG
>probe:Drosophila_2:1640687_at:42:483; Interrogation_Position=483; Antisense; GTACCAAGCCCGTGCCGAAATGGAG
>probe:Drosophila_2:1640687_at:555:179; Interrogation_Position=49; Antisense; AAAACTAATACATTGCCCCATTGGG
>probe:Drosophila_2:1640687_at:709:137; Interrogation_Position=518; Antisense; ACGAGGAACGCACCCGGCAGAAGAT
>probe:Drosophila_2:1640687_at:563:233; Interrogation_Position=82; Antisense; AATGCCCCTGTTGTCTATAAGGCGG

Paste this into a BLAST search page for me
GGATGTGGAAGCCATGACCGTCCTACTAGATTGCCATCGGCTCAAGCGGGAGGAGGGTCTCGATCCCGGAAGATTAAGATTGGTGGGTCTATTGCTGGCCCTTCTTTTCGTTCTCTTGTGTCGAAAAATGTCGGGATCTCTTCAAAACTAGAAGCTCCATCCGTTTTACCTCAAAGAGCCGCCAACTGCAAGAGCTGGATATGCGCAGGAGCTGTAGGCCATTCTGAATCCCAGCTAAGACAGTACCAAGGTACCAAGCCCGTGCCGAAATGGAGAAAACTAATACATTGCCCCATTGGGACGAGGAACGCACCCGGCAGAAGATAATGCCCCTGTTGTCTATAAGGCGG

Full Affymetrix probeset data:

Annotations for 1640687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720