Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640689_a_at:

>probe:Drosophila_2:1640689_a_at:40:57; Interrogation_Position=412; Antisense; ATGAGGAGAAGTCAGCCGCCTCCAA
>probe:Drosophila_2:1640689_a_at:288:561; Interrogation_Position=470; Antisense; GGAAACTCAAGGACGCGCCAGCAGT
>probe:Drosophila_2:1640689_a_at:695:93; Interrogation_Position=492; Antisense; AGTTCGACGTCCACAGCAAGCAAGC
>probe:Drosophila_2:1640689_a_at:431:155; Interrogation_Position=534; Antisense; ACAGCGCCCTCTGGCAATAAATCAA
>probe:Drosophila_2:1640689_a_at:234:99; Interrogation_Position=569; Antisense; AGATGCGGAGCAGGACACCATTCCC
>probe:Drosophila_2:1640689_a_at:49:293; Interrogation_Position=593; Antisense; CGTTTCAGGATCTACCGGATTCGAT
>probe:Drosophila_2:1640689_a_at:653:183; Interrogation_Position=634; Antisense; AAAAGATCTTGGGTGCCTCCGACAA
>probe:Drosophila_2:1640689_a_at:33:317; Interrogation_Position=667; Antisense; GCCTGACATTCCTCATTCAGTTCAA
>probe:Drosophila_2:1640689_a_at:598:209; Interrogation_Position=703; Antisense; AAGCAGAAATGGTGCCCTCCTCAGT
>probe:Drosophila_2:1640689_a_at:322:229; Interrogation_Position=749; Antisense; AATGGTAATCCACTTCTACGAAGAG
>probe:Drosophila_2:1640689_a_at:361:669; Interrogation_Position=765; Antisense; TACGAAGAGCGCCTATCCTGGTACT
>probe:Drosophila_2:1640689_a_at:481:363; Interrogation_Position=869; Antisense; GAATTATAGCTCCTTGCAGGCGCTT
>probe:Drosophila_2:1640689_a_at:593:309; Interrogation_Position=904; Antisense; CCAACCAACTCTTAAGGCATCGGAC
>probe:Drosophila_2:1640689_a_at:195:565; Interrogation_Position=919; Antisense; GGCATCGGACTTTTTTCCATAAATG

Paste this into a BLAST search page for me
ATGAGGAGAAGTCAGCCGCCTCCAAGGAAACTCAAGGACGCGCCAGCAGTAGTTCGACGTCCACAGCAAGCAAGCACAGCGCCCTCTGGCAATAAATCAAAGATGCGGAGCAGGACACCATTCCCCGTTTCAGGATCTACCGGATTCGATAAAAGATCTTGGGTGCCTCCGACAAGCCTGACATTCCTCATTCAGTTCAAAAGCAGAAATGGTGCCCTCCTCAGTAATGGTAATCCACTTCTACGAAGAGTACGAAGAGCGCCTATCCTGGTACTGAATTATAGCTCCTTGCAGGCGCTTCCAACCAACTCTTAAGGCATCGGACGGCATCGGACTTTTTTCCATAAATG

Full Affymetrix probeset data:

Annotations for 1640689_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime