FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640690_at:

>probe:Drosophila_2:1640690_at:382:373; Interrogation_Position=157; Antisense; GAAGTCTGGCGCTATGAGCCCAAGG
>probe:Drosophila_2:1640690_at:327:403; Interrogation_Position=227; Antisense; GACTCGGCGTGGGATTCTGCGCTTT
>probe:Drosophila_2:1640690_at:728:221; Interrogation_Position=343; Antisense; AAGGGCCACCATTAGATATACTGAA
>probe:Drosophila_2:1640690_at:220:29; Interrogation_Position=367; Antisense; ATAAACCCATTGTGCTATCGCTCCA
>probe:Drosophila_2:1640690_at:166:633; Interrogation_Position=384; Antisense; TCGCTCCAATTCACTTTATTCGCAA
>probe:Drosophila_2:1640690_at:247:339; Interrogation_Position=438; Antisense; GCTAAAGTAGTCCTCCGATCAGTTA
>probe:Drosophila_2:1640690_at:583:655; Interrogation_Position=461; Antisense; TAATGCGCGGCTTGAGCTCGTCGTA
>probe:Drosophila_2:1640690_at:613:705; Interrogation_Position=511; Antisense; TTCTTGGCCGGGTTGAAGTACTCGT
>probe:Drosophila_2:1640690_at:459:573; Interrogation_Position=561; Antisense; GGCGTACGCAAATATCTGGCCGTTG
>probe:Drosophila_2:1640690_at:67:577; Interrogation_Position=577; Antisense; TGGCCGTTGGCGTTAAATCCGCATT
>probe:Drosophila_2:1640690_at:367:229; Interrogation_Position=606; Antisense; AATGGACTGATCCATGGTCTCGCTG
>probe:Drosophila_2:1640690_at:644:149; Interrogation_Position=632; Antisense; ACTTGAGCTTGGTCCGGGCATCCTT
>probe:Drosophila_2:1640690_at:251:525; Interrogation_Position=647; Antisense; GGGCATCCTTGTCCCAGAAACTGAA
>probe:Drosophila_2:1640690_at:153:195; Interrogation_Position=665; Antisense; AACTGAAGGTGCCATCTGAGCCAAC

Paste this into a BLAST search page for me
GAAGTCTGGCGCTATGAGCCCAAGGGACTCGGCGTGGGATTCTGCGCTTTAAGGGCCACCATTAGATATACTGAAATAAACCCATTGTGCTATCGCTCCATCGCTCCAATTCACTTTATTCGCAAGCTAAAGTAGTCCTCCGATCAGTTATAATGCGCGGCTTGAGCTCGTCGTATTCTTGGCCGGGTTGAAGTACTCGTGGCGTACGCAAATATCTGGCCGTTGTGGCCGTTGGCGTTAAATCCGCATTAATGGACTGATCCATGGTCTCGCTGACTTGAGCTTGGTCCGGGCATCCTTGGGCATCCTTGTCCCAGAAACTGAAAACTGAAGGTGCCATCTGAGCCAAC

Full Affymetrix probeset data:

Annotations for 1640690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720