FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640691_at:

>probe:Drosophila_2:1640691_at:307:63; Interrogation_Position=1782; Antisense; ATGTGAACAACTGTCCCACGTGCAA
>probe:Drosophila_2:1640691_at:282:233; Interrogation_Position=1805; Antisense; AATGCCTACTTCACGGTCATGGTGC
>probe:Drosophila_2:1640691_at:727:621; Interrogation_Position=1850; Antisense; TGCGGCCACATCTACTGCGATAAGT
>probe:Drosophila_2:1640691_at:425:181; Interrogation_Position=1883; Antisense; AAAACGGTGCCATCTGGACCACGGA
>probe:Drosophila_2:1640691_at:525:433; Interrogation_Position=1911; Antisense; GAGTGGCCCGAGTCTGTGATATCTG
>probe:Drosophila_2:1640691_at:547:513; Interrogation_Position=1926; Antisense; GTGATATCTGTCACACGCTGCTCAC
>probe:Drosophila_2:1640691_at:597:503; Interrogation_Position=2023; Antisense; GTCCAACTAGGCGTTTGGGCTCCAA
>probe:Drosophila_2:1640691_at:449:37; Interrogation_Position=2097; Antisense; ATCTCCTTGAACTCTATTGCTCTAT
>probe:Drosophila_2:1640691_at:561:7; Interrogation_Position=2112; Antisense; ATTGCTCTATTTCTGTGCTCCGATA
>probe:Drosophila_2:1640691_at:397:335; Interrogation_Position=2128; Antisense; GCTCCGATACTACGATTACGATCCG
>probe:Drosophila_2:1640691_at:132:449; Interrogation_Position=2147; Antisense; GATCCGAGGTCAAACCTTTCCAATG
>probe:Drosophila_2:1640691_at:125:499; Interrogation_Position=2191; Antisense; GTCTATTTCCGATTTTGTTGTTCCA
>probe:Drosophila_2:1640691_at:531:465; Interrogation_Position=2207; Antisense; GTTGTTCCATTATTTTGGCCCTATA
>probe:Drosophila_2:1640691_at:352:467; Interrogation_Position=2249; Antisense; GTTGTCTATGTTAGCTTTCGTCGTA

Paste this into a BLAST search page for me
ATGTGAACAACTGTCCCACGTGCAAAATGCCTACTTCACGGTCATGGTGCTGCGGCCACATCTACTGCGATAAGTAAAACGGTGCCATCTGGACCACGGAGAGTGGCCCGAGTCTGTGATATCTGGTGATATCTGTCACACGCTGCTCACGTCCAACTAGGCGTTTGGGCTCCAAATCTCCTTGAACTCTATTGCTCTATATTGCTCTATTTCTGTGCTCCGATAGCTCCGATACTACGATTACGATCCGGATCCGAGGTCAAACCTTTCCAATGGTCTATTTCCGATTTTGTTGTTCCAGTTGTTCCATTATTTTGGCCCTATAGTTGTCTATGTTAGCTTTCGTCGTA

Full Affymetrix probeset data:

Annotations for 1640691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720